Incidental Mutation 'R7704:Ifi44'
ID594172
Institutional Source Beutler Lab
Gene Symbol Ifi44
Ensembl Gene ENSMUSG00000028037
Gene Nameinterferon-induced protein 44
SynonymsA430056A10Rik, p44, MTAP44
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7704 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location151730922-151749960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151732424 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 409 (Y409H)
Ref Sequence ENSEMBL: ENSMUSP00000029671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029671]
Predicted Effect probably benign
Transcript: ENSMUST00000029671
AA Change: Y409H

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029671
Gene: ENSMUSG00000028037
AA Change: Y409H

DomainStartEndE-ValueType
Pfam:TLD 26 147 2.8e-7 PFAM
low complexity region 193 208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,268,744 Q540K probably benign Het
Abcc8 C A 7: 46,106,644 W1458L probably damaging Het
Actn4 A T 7: 28,897,042 I676N possibly damaging Het
Adamts10 T C 17: 33,551,152 C1002R probably damaging Het
Agbl2 A C 2: 90,789,005 N58T probably benign Het
Akap12 A T 10: 4,356,082 D1069V probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Cfap65 T A 1: 74,928,368 T184S probably benign Het
Chd1 T C 17: 15,767,475 V1517A probably benign Het
CN725425 T A 15: 91,235,790 V38D possibly damaging Het
Copg1 T A 6: 87,907,958 L712Q probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Ddx21 T C 10: 62,594,086 Y293C probably damaging Het
Ddx46 C T 13: 55,674,019 P839S probably benign Het
Dennd5a A G 7: 109,896,967 V1164A possibly damaging Het
Dync1h1 T A 12: 110,665,766 I4490N probably damaging Het
Ecm1 A C 3: 95,736,531 Y236D probably damaging Het
Fam198a C T 9: 121,951,085 probably benign Het
Fat2 T C 11: 55,284,347 T1847A probably benign Het
Galc T A 12: 98,208,843 I567L probably benign Het
Gm4858 A G 3: 93,074,445 I183V probably benign Het
H6pd T C 4: 149,982,903 D350G probably benign Het
Kdm5a T G 6: 120,427,064 F1210C probably damaging Het
Kdm5b C T 1: 134,587,931 R98C probably damaging Het
Lipt1 T A 1: 37,875,962 C366* probably null Het
Med13 G A 11: 86,345,918 R138* probably null Het
Mterf1a A G 5: 3,891,845 C8R probably benign Het
Ncapg2 A T 12: 116,419,277 I243F probably damaging Het
Nop58 T C 1: 59,705,595 S304P probably damaging Het
Nsd2 T C 5: 33,871,467 *167Q probably null Het
Olfr390 T G 11: 73,787,790 M284R probably damaging Het
Olfr597 T A 7: 103,320,771 M120K Het
Olfr721-ps1 T A 14: 14,407,867 I213N probably damaging Het
Prdm16 C T 4: 154,341,490 G613R probably damaging Het
Prss46 T C 9: 110,849,997 S89P probably damaging Het
Scin T C 12: 40,124,688 N132S possibly damaging Het
Sec14l2 T C 11: 4,108,574 K196R probably benign Het
Sox17 C A 1: 4,493,672 probably benign Het
Tango6 A G 8: 106,698,989 T394A probably benign Het
Tbc1d22a T A 15: 86,366,675 I398N probably damaging Het
Tmem8b T C 4: 43,689,461 V285A probably damaging Het
Tnfrsf11b T A 15: 54,260,101 T35S probably benign Het
Unc13c T A 9: 73,699,212 I1289F probably benign Het
Ust C T 10: 8,330,223 V99I probably benign Het
Vmn1r76 A G 7: 11,930,417 V290A probably benign Het
Vmn2r50 T C 7: 10,047,738 N360S probably benign Het
Vmn2r93 T C 17: 18,316,648 I531T probably benign Het
Zap70 T C 1: 36,779,314 probably null Het
Zfp932 A G 5: 110,009,764 N443D probably benign Het
Other mutations in Ifi44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ifi44 APN 3 151749580 missense probably benign 0.03
IGL01477:Ifi44 APN 3 151745998 splice site probably benign
IGL01571:Ifi44 APN 3 151745537 missense probably damaging 0.97
IGL02165:Ifi44 APN 3 151749430 missense probably damaging 1.00
IGL02238:Ifi44 APN 3 151732382 makesense probably null
IGL02609:Ifi44 APN 3 151732497 missense probably damaging 1.00
IGL02650:Ifi44 APN 3 151745855 missense probably damaging 1.00
IGL02726:Ifi44 APN 3 151749596 start gained probably benign
IGL02977:Ifi44 APN 3 151739379 missense probably benign 0.00
R0201:Ifi44 UTSW 3 151745636 missense probably damaging 1.00
R0454:Ifi44 UTSW 3 151745497 missense possibly damaging 0.78
R0763:Ifi44 UTSW 3 151749498 missense probably damaging 1.00
R1640:Ifi44 UTSW 3 151732534 missense probably benign 0.00
R1747:Ifi44 UTSW 3 151749285 missense probably benign 0.00
R2278:Ifi44 UTSW 3 151732388 missense probably benign
R3816:Ifi44 UTSW 3 151749257 missense possibly damaging 0.92
R4075:Ifi44 UTSW 3 151745976 missense probably benign 0.00
R4084:Ifi44 UTSW 3 151745489 critical splice donor site probably null
R4782:Ifi44 UTSW 3 151745592 missense probably damaging 0.99
R5071:Ifi44 UTSW 3 151749632 start gained probably benign
R5074:Ifi44 UTSW 3 151749632 start gained probably benign
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6128:Ifi44 UTSW 3 151749186 missense probably benign 0.00
R6192:Ifi44 UTSW 3 151745639 critical splice acceptor site probably null
R6434:Ifi44 UTSW 3 151749189 missense probably benign 0.02
R6536:Ifi44 UTSW 3 151732489 missense probably benign 0.03
R6902:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R6946:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R7346:Ifi44 UTSW 3 151732457 missense probably benign
R7608:Ifi44 UTSW 3 151732408 missense probably damaging 0.97
R8255:Ifi44 UTSW 3 151745982 missense probably benign 0.00
Z1176:Ifi44 UTSW 3 151732453 missense probably damaging 1.00
Z1177:Ifi44 UTSW 3 151749438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCAAGACTGATTTGAGGAAG -3'
(R):5'- CCGTTTTACACAGCTCTGGG -3'

Sequencing Primer
(F):5'- CCAAGACTGATTTGAGGAAGATATC -3'
(R):5'- ACACAGCTCTGGGTTTCCAC -3'
Posted On2019-11-12