Mutagenetix > Incidental Mutations

Incidental Mutation 'R7704:Kdm5a'

594181

Institutional Source

Beutler Lab

Gene Symbol

Kdm5a

Ensembl Gene

ENSMUSG00000030180

Gene Name

lysine (K)-specific demethylase 5A

Synonyms

Jarid1a, Rbbp2, RBP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7704 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120364124-120444574 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 120427064 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Cysteine at position 1210 (F1210C)

Ref Sequence

ENSEMBL: ENSMUSP00000005108 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005108]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005108
AA Change: F1210C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: F1210C

Domain	Start	End	E-Value	Type
JmjN	18	59	4.06e-20	SMART
ARID	81	170	4.76e-35	SMART
BRIGHT	85	175	2.48e-31	SMART
PHD	295	341	1.16e-14	SMART
Blast:JmjC	384	436	2e-22	BLAST
JmjC	437	603	5.88e-73	SMART
low complexity region	638	651	N/A	INTRINSIC
Pfam:zf-C5HC2	676	729	1.3e-21	PFAM
Pfam:PLU-1	740	1072	1.2e-104	PFAM
low complexity region	1091	1119	N/A	INTRINSIC
PHD	1163	1216	1.37e-11	SMART
low complexity region	1269	1280	N/A	INTRINSIC
low complexity region	1337	1351	N/A	INTRINSIC
low complexity region	1403	1414	N/A	INTRINSIC
low complexity region	1494	1512	N/A	INTRINSIC
coiled coil region	1534	1579	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	C	A	11: 78,268,744	Q540K	probably benign	Het
Abcc8	C	A	7: 46,106,644	W1458L	probably damaging	Het
Actn4	A	T	7: 28,897,042	I676N	possibly damaging	Het
Adamts10	T	C	17: 33,551,152	C1002R	probably damaging	Het
Agbl2	A	C	2: 90,789,005	N58T	probably benign	Het
Akap12	A	T	10: 4,356,082	D1069V	probably damaging	Het
C87977	C	T	4: 144,208,521	V217I	possibly damaging	Het
Cfap65	T	A	1: 74,928,368	T184S	probably benign	Het
Chd1	T	C	17: 15,767,475	V1517A	probably benign	Het
CN725425	T	A	15: 91,235,790	V38D	possibly damaging	Het
Copg1	T	A	6: 87,907,958	L712Q	probably benign	Het
Ctsf	T	G	19: 4,856,539	F165V	probably damaging	Het
Ddx21	T	C	10: 62,594,086	Y293C	probably damaging	Het
Ddx46	C	T	13: 55,674,019	P839S	probably benign	Het
Dennd5a	A	G	7: 109,896,967	V1164A	possibly damaging	Het
Dync1h1	T	A	12: 110,665,766	I4490N	probably damaging	Het
Ecm1	A	C	3: 95,736,531	Y236D	probably damaging	Het
Fam198a	C	T	9: 121,951,085		probably benign	Het
Fat2	T	C	11: 55,284,347	T1847A	probably benign	Het
Galc	T	A	12: 98,208,843	I567L	probably benign	Het
Gm4858	A	G	3: 93,074,445	I183V	probably benign	Het
H6pd	T	C	4: 149,982,903	D350G	probably benign	Het
Ifi44	A	G	3: 151,732,424	Y409H	probably benign	Het
Kdm5b	C	T	1: 134,587,931	R98C	probably damaging	Het
Lipt1	T	A	1: 37,875,962	C366*	probably null	Het
Med13	G	A	11: 86,345,918	R138*	probably null	Het
Mterf1a	A	G	5: 3,891,845	C8R	probably benign	Het
Ncapg2	A	T	12: 116,419,277	I243F	probably damaging	Het
Nop58	T	C	1: 59,705,595	S304P	probably damaging	Het
Nsd2	T	C	5: 33,871,467	*167Q	probably null	Het
Olfr390	T	G	11: 73,787,790	M284R	probably damaging	Het
Olfr597	T	A	7: 103,320,771	M120K		Het
Olfr721-ps1	T	A	14: 14,407,867	I213N	probably damaging	Het
Prdm16	C	T	4: 154,341,490	G613R	probably damaging	Het
Prss46	T	C	9: 110,849,997	S89P	probably damaging	Het
Scin	T	C	12: 40,124,688	N132S	possibly damaging	Het
Sec14l2	T	C	11: 4,108,574	K196R	probably benign	Het
Sox17	C	A	1: 4,493,672		probably benign	Het
Tango6	A	G	8: 106,698,989	T394A	probably benign	Het
Tbc1d22a	T	A	15: 86,366,675	I398N	probably damaging	Het
Tmem8b	T	C	4: 43,689,461	V285A	probably damaging	Het
Tnfrsf11b	T	A	15: 54,260,101	T35S	probably benign	Het
Unc13c	T	A	9: 73,699,212	I1289F	probably benign	Het
Ust	C	T	10: 8,330,223	V99I	probably benign	Het
Vmn1r76	A	G	7: 11,930,417	V290A	probably benign	Het
Vmn2r50	T	C	7: 10,047,738	N360S	probably benign	Het
Vmn2r93	T	C	17: 18,316,648	I531T	probably benign	Het
Zap70	T	C	1: 36,779,314		probably null	Het
Zfp932	A	G	5: 110,009,764	N443D	probably benign	Het

Other mutations in Kdm5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Kdm5a	APN	6	120385719	critical splice donor site	probably null	0.00
IGL00706:Kdm5a	APN	6	120406636	missense	possibly damaging	0.44
IGL01361:Kdm5a	APN	6	120399016	missense	probably damaging	1.00
IGL01402:Kdm5a	APN	6	120390679	nonsense	probably null	0.00
IGL01924:Kdm5a	APN	6	120394255	critical splice donor site	probably null	0.00
IGL01935:Kdm5a	APN	6	120408323	missense	probably benign	0.02
IGL02165:Kdm5a	APN	6	120415290	missense	probably damaging	1.00
IGL02472:Kdm5a	APN	6	120406730	splice site	probably benign
IGL02506:Kdm5a	APN	6	120432149	missense	probably damaging	0.99
IGL02604:Kdm5a	APN	6	120431980	missense	probably benign
IGL02633:Kdm5a	APN	6	120364719	missense	probably damaging	1.00
IGL02876:Kdm5a	APN	6	120390644	unclassified	probably benign
IGL03009:Kdm5a	APN	6	120430086	missense	probably damaging	0.98
IGL03027:Kdm5a	APN	6	120374990	splice site	probably null
IGL03164:Kdm5a	APN	6	120439019	missense	probably damaging	1.00
IGL03236:Kdm5a	APN	6	120438988	missense	probably damaging	0.98
IGL03276:Kdm5a	APN	6	120402708	splice site	probably benign
Augmented	UTSW	6	120430016	intron	probably benign
Calla_lily	UTSW	6	120405022	missense	probably damaging	1.00
crocus	UTSW	6	120399038	missense	probably null	0.98
Magnolia	UTSW	6	120398978	missense	probably damaging	0.99
Selbst	UTSW	6	120388105	nonsense	probably null
R0320:Kdm5a	UTSW	6	120389620	missense	probably benign	0.19
R0462:Kdm5a	UTSW	6	120402600	missense	probably damaging	1.00
R0601:Kdm5a	UTSW	6	120402671	missense	possibly damaging	0.76
R0628:Kdm5a	UTSW	6	120415239	missense	probably damaging	1.00
R1024:Kdm5a	UTSW	6	120399038	missense	probably null	0.98
R2013:Kdm5a	UTSW	6	120431990	missense	probably benign	0.09
R2015:Kdm5a	UTSW	6	120431990	missense	probably benign	0.09
R2061:Kdm5a	UTSW	6	120381617	missense	probably benign
R2188:Kdm5a	UTSW	6	120406640	missense	possibly damaging	0.59
R3923:Kdm5a	UTSW	6	120381664	missense	probably benign	0.01
R4013:Kdm5a	UTSW	6	120394106	missense	probably damaging	1.00
R4016:Kdm5a	UTSW	6	120394106	missense	probably damaging	1.00
R4017:Kdm5a	UTSW	6	120394106	missense	probably damaging	1.00
R4030:Kdm5a	UTSW	6	120405113	nonsense	probably null
R4646:Kdm5a	UTSW	6	120374977	missense	possibly damaging	0.55
R4737:Kdm5a	UTSW	6	120406015	intron	probably benign
R4779:Kdm5a	UTSW	6	120369099	unclassified	probably benign
R4836:Kdm5a	UTSW	6	120412402	missense	probably damaging	1.00
R5129:Kdm5a	UTSW	6	120405022	missense	probably damaging	1.00
R5182:Kdm5a	UTSW	6	120388105	nonsense	probably null
R5183:Kdm5a	UTSW	6	120430016	intron	probably benign
R5572:Kdm5a	UTSW	6	120412375	missense	possibly damaging	0.69
R6110:Kdm5a	UTSW	6	120412306	missense	probably damaging	1.00
R6132:Kdm5a	UTSW	6	120374931	missense	probably damaging	1.00
R6198:Kdm5a	UTSW	6	120438997	missense	probably benign	0.37
R6246:Kdm5a	UTSW	6	120431910	missense	probably damaging	0.97
R6336:Kdm5a	UTSW	6	120398978	missense	probably damaging	0.99
R6343:Kdm5a	UTSW	6	120382933	missense	probably benign	0.01
R6612:Kdm5a	UTSW	6	120430228	missense	probably damaging	0.99
R6647:Kdm5a	UTSW	6	120412461	missense	probably benign	0.25
R7068:Kdm5a	UTSW	6	120430215	missense	probably benign	0.40
R7369:Kdm5a	UTSW	6	120432004	missense	possibly damaging	0.67
R7380:Kdm5a	UTSW	6	120405918	missense	probably benign	0.35
R7411:Kdm5a	UTSW	6	120426815	missense	probably damaging	1.00
R7521:Kdm5a	UTSW	6	120432187	nonsense	probably null
R7570:Kdm5a	UTSW	6	120427842	missense	probably damaging	0.99
R7647:Kdm5a	UTSW	6	120427786	missense	probably benign	0.01
R7796:Kdm5a	UTSW	6	120390763	missense	probably damaging	1.00
R7875:Kdm5a	UTSW	6	120399018	nonsense	probably null
R8265:Kdm5a	UTSW	6	120406596	missense	possibly damaging	0.72
R8297:Kdm5a	UTSW	6	120381555	missense	probably benign	0.00
R8336:Kdm5a	UTSW	6	120419446	missense	probably benign	0.00
R8471:Kdm5a	UTSW	6	120430231	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAAGCCATGCATTCCCTCAG -3'
(R):5'- AGGGCAGAGGACAGTTCATC -3'

Sequencing Primer
(F):5'- CCTAGCCAAGATGACAATTGTG -3'
(R):5'- CAGTTCATCTGTGGCTAAAGC -3'

Posted On

2019-11-12