Incidental Mutation 'R7704:Kdm5a'
ID594181
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7704 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120427064 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 1210 (F1210C)
Ref Sequence ENSEMBL: ENSMUSP00000005108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108]
Predicted Effect probably damaging
Transcript: ENSMUST00000005108
AA Change: F1210C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: F1210C

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,268,744 Q540K probably benign Het
Abcc8 C A 7: 46,106,644 W1458L probably damaging Het
Actn4 A T 7: 28,897,042 I676N possibly damaging Het
Adamts10 T C 17: 33,551,152 C1002R probably damaging Het
Agbl2 A C 2: 90,789,005 N58T probably benign Het
Akap12 A T 10: 4,356,082 D1069V probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Cfap65 T A 1: 74,928,368 T184S probably benign Het
Chd1 T C 17: 15,767,475 V1517A probably benign Het
CN725425 T A 15: 91,235,790 V38D possibly damaging Het
Copg1 T A 6: 87,907,958 L712Q probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Ddx21 T C 10: 62,594,086 Y293C probably damaging Het
Ddx46 C T 13: 55,674,019 P839S probably benign Het
Dennd5a A G 7: 109,896,967 V1164A possibly damaging Het
Dync1h1 T A 12: 110,665,766 I4490N probably damaging Het
Ecm1 A C 3: 95,736,531 Y236D probably damaging Het
Fam198a C T 9: 121,951,085 probably benign Het
Fat2 T C 11: 55,284,347 T1847A probably benign Het
Galc T A 12: 98,208,843 I567L probably benign Het
Gm4858 A G 3: 93,074,445 I183V probably benign Het
H6pd T C 4: 149,982,903 D350G probably benign Het
Ifi44 A G 3: 151,732,424 Y409H probably benign Het
Kdm5b C T 1: 134,587,931 R98C probably damaging Het
Lipt1 T A 1: 37,875,962 C366* probably null Het
Med13 G A 11: 86,345,918 R138* probably null Het
Mterf1a A G 5: 3,891,845 C8R probably benign Het
Ncapg2 A T 12: 116,419,277 I243F probably damaging Het
Nop58 T C 1: 59,705,595 S304P probably damaging Het
Nsd2 T C 5: 33,871,467 *167Q probably null Het
Olfr390 T G 11: 73,787,790 M284R probably damaging Het
Olfr597 T A 7: 103,320,771 M120K Het
Olfr721-ps1 T A 14: 14,407,867 I213N probably damaging Het
Prdm16 C T 4: 154,341,490 G613R probably damaging Het
Prss46 T C 9: 110,849,997 S89P probably damaging Het
Scin T C 12: 40,124,688 N132S possibly damaging Het
Sec14l2 T C 11: 4,108,574 K196R probably benign Het
Sox17 C A 1: 4,493,672 probably benign Het
Tango6 A G 8: 106,698,989 T394A probably benign Het
Tbc1d22a T A 15: 86,366,675 I398N probably damaging Het
Tmem8b T C 4: 43,689,461 V285A probably damaging Het
Tnfrsf11b T A 15: 54,260,101 T35S probably benign Het
Unc13c T A 9: 73,699,212 I1289F probably benign Het
Ust C T 10: 8,330,223 V99I probably benign Het
Vmn1r76 A G 7: 11,930,417 V290A probably benign Het
Vmn2r50 T C 7: 10,047,738 N360S probably benign Het
Vmn2r93 T C 17: 18,316,648 I531T probably benign Het
Zap70 T C 1: 36,779,314 probably null Het
Zfp932 A G 5: 110,009,764 N443D probably benign Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
Calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2061:Kdm5a UTSW 6 120381617 missense probably benign
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R3923:Kdm5a UTSW 6 120381664 missense probably benign 0.01
R4013:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6110:Kdm5a UTSW 6 120412306 missense probably damaging 1.00
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6612:Kdm5a UTSW 6 120430228 missense probably damaging 0.99
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7380:Kdm5a UTSW 6 120405918 missense probably benign 0.35
R7411:Kdm5a UTSW 6 120426815 missense probably damaging 1.00
R7521:Kdm5a UTSW 6 120432187 nonsense probably null
R7570:Kdm5a UTSW 6 120427842 missense probably damaging 0.99
R7647:Kdm5a UTSW 6 120427786 missense probably benign 0.01
R7796:Kdm5a UTSW 6 120390763 missense probably damaging 1.00
R7875:Kdm5a UTSW 6 120399018 nonsense probably null
R8265:Kdm5a UTSW 6 120406596 missense possibly damaging 0.72
R8297:Kdm5a UTSW 6 120381555 missense probably benign 0.00
R8336:Kdm5a UTSW 6 120419446 missense probably benign 0.00
R8471:Kdm5a UTSW 6 120430231 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAGCCATGCATTCCCTCAG -3'
(R):5'- AGGGCAGAGGACAGTTCATC -3'

Sequencing Primer
(F):5'- CCTAGCCAAGATGACAATTGTG -3'
(R):5'- CAGTTCATCTGTGGCTAAAGC -3'
Posted On2019-11-12