Mutagenetix > Incidental Mutation

Incidental Mutation 'R7704:Unc13c'

594189

Institutional Source

Beutler Lab

Gene Symbol

Unc13c

Ensembl Gene

ENSMUSG00000062151

Gene Name

unc-13 homolog C (C. elegans)

Synonyms

Munc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7704 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73479422-73968966 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73699212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1289 (I1289F)

Ref Sequence

ENSEMBL: ENSMUSP00000074726 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]

AlphaFold

Q8K0T7

Predicted Effect

probably benign
Transcript: ENSMUST00000075245
AA Change: I1289F

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: I1289F

Domain	Start	End	E-Value	Type
low complexity region	109	127	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
low complexity region	273	287	N/A	INTRINSIC
low complexity region	464	491	N/A	INTRINSIC
low complexity region	678	694	N/A	INTRINSIC
C1	1094	1143	1.37e-17	SMART
C2	1217	1324	1.46e-22	SMART
DUF1041	1535	1642	3.18e-51	SMART
Blast:DUF1041	1714	1838	2e-49	BLAST
Pfam:Membr_traf_MHD	1883	2023	2.6e-50	PFAM
C2	2058	2164	4.15e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184666
AA Change: I1289F

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: I1289F

Domain	Start	End	E-Value	Type
low complexity region	109	127	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
low complexity region	273	287	N/A	INTRINSIC
low complexity region	464	491	N/A	INTRINSIC
low complexity region	678	694	N/A	INTRINSIC
C1	1094	1143	1.37e-17	SMART
C2	1217	1324	1.46e-22	SMART
DUF1041	1535	1642	3.18e-51	SMART
Blast:DUF1041	1714	1838	2e-49	BLAST
Pfam:Membr_traf_MHD	1882	2024	8.3e-59	PFAM
C2	2058	2164	4.15e-13	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	C	A	11: 78,268,744	Q540K	probably benign	Het
Abcc8	C	A	7: 46,106,644	W1458L	probably damaging	Het
Actn4	A	T	7: 28,897,042	I676N	possibly damaging	Het
Adamts10	T	C	17: 33,551,152	C1002R	probably damaging	Het
Agbl2	A	C	2: 90,789,005	N58T	probably benign	Het
Akap12	A	T	10: 4,356,082	D1069V	probably damaging	Het
C87977	C	T	4: 144,208,521	V217I	possibly damaging	Het
Cfap65	T	A	1: 74,928,368	T184S	probably benign	Het
Chd1	T	C	17: 15,767,475	V1517A	probably benign	Het
CN725425	T	A	15: 91,235,790	V38D	possibly damaging	Het
Copg1	T	A	6: 87,907,958	L712Q	probably benign	Het
Ctsf	T	G	19: 4,856,539	F165V	probably damaging	Het
Ddx21	T	C	10: 62,594,086	Y293C	probably damaging	Het
Ddx46	C	T	13: 55,674,019	P839S	probably benign	Het
Dennd5a	A	G	7: 109,896,967	V1164A	possibly damaging	Het
Dync1h1	T	A	12: 110,665,766	I4490N	probably damaging	Het
Ecm1	A	C	3: 95,736,531	Y236D	probably damaging	Het
Fam198a	C	T	9: 121,951,085		probably benign	Het
Fat2	T	C	11: 55,284,347	T1847A	probably benign	Het
Galc	T	A	12: 98,208,843	I567L	probably benign	Het
Gm4858	A	G	3: 93,074,445	I183V	probably benign	Het
H6pd	T	C	4: 149,982,903	D350G	probably benign	Het
Ifi44	A	G	3: 151,732,424	Y409H	probably benign	Het
Kdm5a	T	G	6: 120,427,064	F1210C	probably damaging	Het
Kdm5b	C	T	1: 134,587,931	R98C	probably damaging	Het
Lipt1	T	A	1: 37,875,962	C366*	probably null	Het
Med13	G	A	11: 86,345,918	R138*	probably null	Het
Mterf1a	A	G	5: 3,891,845	C8R	probably benign	Het
Ncapg2	A	T	12: 116,419,277	I243F	probably damaging	Het
Nop58	T	C	1: 59,705,595	S304P	probably damaging	Het
Nsd2	T	C	5: 33,871,467	*167Q	probably null	Het
Olfr390	T	G	11: 73,787,790	M284R	probably damaging	Het
Olfr597	T	A	7: 103,320,771	M120K		Het
Olfr721-ps1	T	A	14: 14,407,867	I213N	probably damaging	Het
Prdm16	C	T	4: 154,341,490	G613R	probably damaging	Het
Prss46	T	C	9: 110,849,997	S89P	probably damaging	Het
Scin	T	C	12: 40,124,688	N132S	possibly damaging	Het
Sec14l2	T	C	11: 4,108,574	K196R	probably benign	Het
Sox17	C	A	1: 4,493,672		probably benign	Het
Tango6	A	G	8: 106,698,989	T394A	probably benign	Het
Tbc1d22a	T	A	15: 86,366,675	I398N	probably damaging	Het
Tmem8b	T	C	4: 43,689,461	V285A	probably damaging	Het
Tnfrsf11b	T	A	15: 54,260,101	T35S	probably benign	Het
Ust	C	T	10: 8,330,223	V99I	probably benign	Het
Vmn1r76	A	G	7: 11,930,417	V290A	probably benign	Het
Vmn2r50	T	C	7: 10,047,738	N360S	probably benign	Het
Vmn2r93	T	C	17: 18,316,648	I531T	probably benign	Het
Zap70	T	C	1: 36,779,314		probably null	Het
Zfp932	A	G	5: 110,009,764	N443D	probably benign	Het

Other mutations in Unc13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Unc13c	APN	9	73736703	missense	probably damaging	0.99
IGL00693:Unc13c	APN	9	73758602	missense	probably benign	0.18
IGL01022:Unc13c	APN	9	73517328	missense	probably benign	0.06
IGL01088:Unc13c	APN	9	73932281	missense	possibly damaging	0.63
IGL01123:Unc13c	APN	9	73933197	missense	probably benign	0.05
IGL01131:Unc13c	APN	9	73564053	missense	probably benign
IGL01135:Unc13c	APN	9	73484893	missense	probably damaging	1.00
IGL01393:Unc13c	APN	9	73540270	missense	probably benign	0.06
IGL01752:Unc13c	APN	9	73931811	missense	probably benign	0.01
IGL01893:Unc13c	APN	9	73693366	missense	probably benign	0.15
IGL01897:Unc13c	APN	9	73546027	missense	probably damaging	0.99
IGL01936:Unc13c	APN	9	73693242	missense	probably benign	0.07
IGL02122:Unc13c	APN	9	73734397	splice site	probably benign
IGL02341:Unc13c	APN	9	73933210	missense	possibly damaging	0.76
IGL02434:Unc13c	APN	9	73932628	missense	probably benign	0.01
IGL02545:Unc13c	APN	9	73481075	missense	probably damaging	0.98
IGL02709:Unc13c	APN	9	73558956	missense	probably benign	0.00
IGL02815:Unc13c	APN	9	73540263	missense	possibly damaging	0.83
IGL02904:Unc13c	APN	9	73481067	nonsense	probably null
IGL03117:Unc13c	APN	9	73534025	missense	probably benign	0.03
IGL03260:Unc13c	APN	9	73931344	missense	probably benign	0.11
Feeling	UTSW	9	73693271	missense	possibly damaging	0.46
Inkling	UTSW	9	73931844	missense	probably damaging	1.00
notion	UTSW	9	73736562	missense	probably damaging	1.00
BB001:Unc13c	UTSW	9	73734408	missense	probably benign	0.05
BB011:Unc13c	UTSW	9	73734408	missense	probably benign	0.05
PIT4431001:Unc13c	UTSW	9	73749547	missense	probably damaging	0.99
PIT4651001:Unc13c	UTSW	9	73483739	missense	possibly damaging	0.48
R0017:Unc13c	UTSW	9	73693301	missense	probably benign	0.07
R0039:Unc13c	UTSW	9	73669565	splice site	probably benign
R0164:Unc13c	UTSW	9	73694892	missense	probably benign	0.01
R0164:Unc13c	UTSW	9	73694892	missense	probably benign	0.01
R0308:Unc13c	UTSW	9	73481118	missense	probably benign	0.04
R0344:Unc13c	UTSW	9	73930785	missense	probably benign	0.39
R0421:Unc13c	UTSW	9	73933210	missense	possibly damaging	0.76
R0606:Unc13c	UTSW	9	73530983	splice site	probably benign
R0655:Unc13c	UTSW	9	73930953	missense	probably damaging	0.96
R1013:Unc13c	UTSW	9	73933332	missense	probably benign	0.45
R1293:Unc13c	UTSW	9	73574074	missense	probably benign	0.06
R1493:Unc13c	UTSW	9	73639068	missense	probably benign	0.27
R1675:Unc13c	UTSW	9	73639050	critical splice donor site	probably null
R1789:Unc13c	UTSW	9	73756339	missense	possibly damaging	0.92
R2001:Unc13c	UTSW	9	73483615	splice site	probably null
R2055:Unc13c	UTSW	9	73736550	missense	probably damaging	1.00
R2060:Unc13c	UTSW	9	73665656	missense	probably damaging	0.99
R2420:Unc13c	UTSW	9	73931547	missense	probably damaging	0.97
R2421:Unc13c	UTSW	9	73931547	missense	probably damaging	0.97
R2422:Unc13c	UTSW	9	73931547	missense	probably damaging	0.97
R3415:Unc13c	UTSW	9	73932586	missense	probably benign	0.00
R3423:Unc13c	UTSW	9	73930653	missense	possibly damaging	0.46
R3820:Unc13c	UTSW	9	73930958	missense	probably benign	0.00
R3857:Unc13c	UTSW	9	73699108	nonsense	probably null
R3859:Unc13c	UTSW	9	73699108	nonsense	probably null
R3895:Unc13c	UTSW	9	73933523	missense	probably benign
R4038:Unc13c	UTSW	9	73533906	critical splice donor site	probably null
R4077:Unc13c	UTSW	9	73736539	nonsense	probably null
R4125:Unc13c	UTSW	9	73574007	critical splice donor site	probably null
R4128:Unc13c	UTSW	9	73734537	missense	probably damaging	1.00
R4235:Unc13c	UTSW	9	73530952	missense	possibly damaging	0.68
R4295:Unc13c	UTSW	9	73734504	missense	probably damaging	1.00
R4307:Unc13c	UTSW	9	73693367	missense	probably benign	0.06
R4658:Unc13c	UTSW	9	73932826	missense	probably damaging	1.00
R4694:Unc13c	UTSW	9	73572354	missense	probably benign	0.00
R4735:Unc13c	UTSW	9	73693338	missense	probably benign	0.00
R4744:Unc13c	UTSW	9	73931844	missense	probably damaging	1.00
R4795:Unc13c	UTSW	9	73932187	missense	probably damaging	0.97
R4827:Unc13c	UTSW	9	73931286	missense	probably damaging	1.00
R4838:Unc13c	UTSW	9	73932072	missense	possibly damaging	0.68
R4869:Unc13c	UTSW	9	73680434	missense	probably benign	0.02
R4873:Unc13c	UTSW	9	73517284	missense	probably damaging	0.98
R4875:Unc13c	UTSW	9	73517284	missense	probably damaging	0.98
R4876:Unc13c	UTSW	9	73749539	missense	probably damaging	1.00
R4905:Unc13c	UTSW	9	73680392	missense	probably benign
R4912:Unc13c	UTSW	9	73574022	missense	probably damaging	0.99
R5026:Unc13c	UTSW	9	73930903	missense	possibly damaging	0.74
R5127:Unc13c	UTSW	9	73933372	missense	probably benign	0.26
R5151:Unc13c	UTSW	9	73931475	missense	probably benign	0.02
R5171:Unc13c	UTSW	9	73757954	missense	probably benign
R5244:Unc13c	UTSW	9	73525951	critical splice donor site	probably null
R5342:Unc13c	UTSW	9	73930823	missense	probably benign	0.00
R5399:Unc13c	UTSW	9	73749688	missense	possibly damaging	0.95
R5409:Unc13c	UTSW	9	73578390	missense	possibly damaging	0.78
R5460:Unc13c	UTSW	9	73545989	missense	probably benign
R5680:Unc13c	UTSW	9	73932602	missense	probably damaging	1.00
R5681:Unc13c	UTSW	9	73546075	splice site	probably null
R5728:Unc13c	UTSW	9	73558956	missense	probably benign	0.01
R5762:Unc13c	UTSW	9	73812367	missense	probably benign	0.00
R5764:Unc13c	UTSW	9	73533903	splice site	probably null
R5829:Unc13c	UTSW	9	73693368	missense	probably benign	0.15
R5894:Unc13c	UTSW	9	73693204	critical splice donor site	probably null
R5936:Unc13c	UTSW	9	73578492	missense	probably damaging	1.00
R6043:Unc13c	UTSW	9	73736651	missense	possibly damaging	0.88
R6046:Unc13c	UTSW	9	73930884	missense	probably benign
R6148:Unc13c	UTSW	9	73693366	missense	probably benign	0.15
R6207:Unc13c	UTSW	9	73758628	missense	possibly damaging	0.89
R6277:Unc13c	UTSW	9	73699169	missense	probably damaging	1.00
R6338:Unc13c	UTSW	9	73734447	missense	probably damaging	0.99
R6615:Unc13c	UTSW	9	73930608	missense	possibly damaging	0.63
R6978:Unc13c	UTSW	9	73931977	missense	probably benign	0.39
R7053:Unc13c	UTSW	9	73932297	missense	probably damaging	1.00
R7223:Unc13c	UTSW	9	73629191	missense	probably benign	0.44
R7259:Unc13c	UTSW	9	73517363	missense	probably benign	0.00
R7353:Unc13c	UTSW	9	73574073	missense	probably benign	0.00
R7357:Unc13c	UTSW	9	73933528	small insertion	probably benign
R7357:Unc13c	UTSW	9	73933529	small insertion	probably benign
R7607:Unc13c	UTSW	9	73669535	missense	probably damaging	0.98
R7626:Unc13c	UTSW	9	73734517	missense	probably damaging	1.00
R7639:Unc13c	UTSW	9	73933168	missense	probably damaging	0.99
R7657:Unc13c	UTSW	9	73533903	splice site	probably null
R7665:Unc13c	UTSW	9	73680474	missense	probably benign	0.28
R7776:Unc13c	UTSW	9	73694950	missense	probably damaging	1.00
R7811:Unc13c	UTSW	9	73693271	missense	possibly damaging	0.46
R7833:Unc13c	UTSW	9	73481109	missense	possibly damaging	0.53
R7839:Unc13c	UTSW	9	73933314	missense	possibly damaging	0.63
R7869:Unc13c	UTSW	9	73694877	missense	probably damaging	1.00
R7924:Unc13c	UTSW	9	73734408	missense	probably benign	0.05
R8047:Unc13c	UTSW	9	73812354	nonsense	probably null
R8167:Unc13c	UTSW	9	73736703	missense	probably damaging	0.99
R8202:Unc13c	UTSW	9	73736562	missense	probably damaging	1.00
R8210:Unc13c	UTSW	9	73484938	missense	probably benign	0.13
R8352:Unc13c	UTSW	9	73931008	missense	probably damaging	0.99
R8368:Unc13c	UTSW	9	73930788	missense	probably benign	0.15
R8452:Unc13c	UTSW	9	73931008	missense	probably damaging	0.99
R8535:Unc13c	UTSW	9	73540371	missense	probably benign
R8677:Unc13c	UTSW	9	73932961	missense	probably benign	0.00
R8700:Unc13c	UTSW	9	73572397	missense	probably benign	0.44
R8848:Unc13c	UTSW	9	73525981	missense	probably benign
R8902:Unc13c	UTSW	9	73749548	missense	probably damaging	0.97
R8953:Unc13c	UTSW	9	73932762	missense	probably benign	0.00
R8961:Unc13c	UTSW	9	73932242	missense	probably benign	0.06
R9015:Unc13c	UTSW	9	73546040	missense	probably benign
R9114:Unc13c	UTSW	9	73812383	missense	probably benign	0.02
R9217:Unc13c	UTSW	9	73578433	missense	probably damaging	1.00
R9252:Unc13c	UTSW	9	73517271	missense	possibly damaging	0.80
R9273:Unc13c	UTSW	9	73932580	missense	possibly damaging	0.96
R9317:Unc13c	UTSW	9	73540380	missense	possibly damaging	0.88
R9412:Unc13c	UTSW	9	73932490	missense	probably benign
R9505:Unc13c	UTSW	9	73931542	missense	probably benign	0.22
R9516:Unc13c	UTSW	9	73484938	missense	probably damaging	0.99
R9528:Unc13c	UTSW	9	73930678	missense	possibly damaging	0.48
R9567:Unc13c	UTSW	9	73629203	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGACAATTACCCTTCATTGCTAATG -3'
(R):5'- CATGGCTGGAAGGGGAATCC -3'

Sequencing Primer
(F):5'- GTCAACAGAATGACCTGCAAAAG -3'
(R):5'- GGGGAATCCTCATTTATAACTCAATG -3'

Posted On

2019-11-12