Incidental Mutation 'R7704:Akap12'
ID594192
Institutional Source Beutler Lab
Gene Symbol Akap12
Ensembl Gene ENSMUSG00000038587
Gene NameA kinase (PRKA) anchor protein (gravin) 12
SynonymsSSeCKS, Tsga12, Srcs5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7704 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location4266380-4359470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4356082 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1069 (D1069V)
Ref Sequence ENSEMBL: ENSMUSP00000035829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]
Predicted Effect probably damaging
Transcript: ENSMUST00000045730
AA Change: D1069V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: D1069V

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 151 171 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
internal_repeat_1 212 279 3.2e-5 PROSPERO
coiled coil region 304 331 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 497 526 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
Pfam:WSK 591 619 2e-15 PFAM
low complexity region 626 637 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
low complexity region 700 711 N/A INTRINSIC
Pfam:WSK 738 766 2.3e-15 PFAM
Pfam:WSK 779 807 6.2e-11 PFAM
low complexity region 951 973 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
internal_repeat_1 1197 1265 3.2e-5 PROSPERO
low complexity region 1303 1312 N/A INTRINSIC
Pfam:RII_binding_1 1501 1518 4.2e-7 PFAM
coiled coil region 1651 1676 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215696
AA Change: D964V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,268,744 Q540K probably benign Het
Abcc8 C A 7: 46,106,644 W1458L probably damaging Het
Actn4 A T 7: 28,897,042 I676N possibly damaging Het
Adamts10 T C 17: 33,551,152 C1002R probably damaging Het
Agbl2 A C 2: 90,789,005 N58T probably benign Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Cfap65 T A 1: 74,928,368 T184S probably benign Het
Chd1 T C 17: 15,767,475 V1517A probably benign Het
CN725425 T A 15: 91,235,790 V38D possibly damaging Het
Copg1 T A 6: 87,907,958 L712Q probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Ddx21 T C 10: 62,594,086 Y293C probably damaging Het
Ddx46 C T 13: 55,674,019 P839S probably benign Het
Dennd5a A G 7: 109,896,967 V1164A possibly damaging Het
Dync1h1 T A 12: 110,665,766 I4490N probably damaging Het
Ecm1 A C 3: 95,736,531 Y236D probably damaging Het
Fam198a C T 9: 121,951,085 probably benign Het
Fat2 T C 11: 55,284,347 T1847A probably benign Het
Galc T A 12: 98,208,843 I567L probably benign Het
Gm4858 A G 3: 93,074,445 I183V probably benign Het
H6pd T C 4: 149,982,903 D350G probably benign Het
Ifi44 A G 3: 151,732,424 Y409H probably benign Het
Kdm5a T G 6: 120,427,064 F1210C probably damaging Het
Kdm5b C T 1: 134,587,931 R98C probably damaging Het
Lipt1 T A 1: 37,875,962 C366* probably null Het
Med13 G A 11: 86,345,918 R138* probably null Het
Mterf1a A G 5: 3,891,845 C8R probably benign Het
Ncapg2 A T 12: 116,419,277 I243F probably damaging Het
Nop58 T C 1: 59,705,595 S304P probably damaging Het
Nsd2 T C 5: 33,871,467 *167Q probably null Het
Olfr390 T G 11: 73,787,790 M284R probably damaging Het
Olfr597 T A 7: 103,320,771 M120K Het
Olfr721-ps1 T A 14: 14,407,867 I213N probably damaging Het
Prdm16 C T 4: 154,341,490 G613R probably damaging Het
Prss46 T C 9: 110,849,997 S89P probably damaging Het
Scin T C 12: 40,124,688 N132S possibly damaging Het
Sec14l2 T C 11: 4,108,574 K196R probably benign Het
Sox17 C A 1: 4,493,672 probably benign Het
Tango6 A G 8: 106,698,989 T394A probably benign Het
Tbc1d22a T A 15: 86,366,675 I398N probably damaging Het
Tmem8b T C 4: 43,689,461 V285A probably damaging Het
Tnfrsf11b T A 15: 54,260,101 T35S probably benign Het
Unc13c T A 9: 73,699,212 I1289F probably benign Het
Ust C T 10: 8,330,223 V99I probably benign Het
Vmn1r76 A G 7: 11,930,417 V290A probably benign Het
Vmn2r50 T C 7: 10,047,738 N360S probably benign Het
Vmn2r93 T C 17: 18,316,648 I531T probably benign Het
Zap70 T C 1: 36,779,314 probably null Het
Zfp932 A G 5: 110,009,764 N443D probably benign Het
Other mutations in Akap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Akap12 APN 10 4357164 missense probably benign 0.09
IGL01306:Akap12 APN 10 4353273 missense probably benign 0.04
IGL01360:Akap12 APN 10 4357537 missense probably benign 0.02
IGL01455:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL01458:Akap12 APN 10 4354060 missense probably damaging 1.00
IGL01465:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL02348:Akap12 APN 10 4354722 missense probably damaging 1.00
IGL02425:Akap12 APN 10 4356034 missense possibly damaging 0.67
IGL02502:Akap12 APN 10 4353163 missense probably damaging 1.00
IGL02736:Akap12 APN 10 4355637 missense probably benign
IGL02969:Akap12 APN 10 4354864 missense probably damaging 1.00
IGL03345:Akap12 APN 10 4356697 missense probably benign 0.42
ANU23:Akap12 UTSW 10 4353273 missense probably benign 0.04
FR4976:Akap12 UTSW 10 4353837 small insertion probably benign
R0004:Akap12 UTSW 10 4353220 missense probably damaging 1.00
R0004:Akap12 UTSW 10 4353218 missense possibly damaging 0.56
R0207:Akap12 UTSW 10 4353333 missense probably damaging 1.00
R0580:Akap12 UTSW 10 4354741 missense possibly damaging 0.91
R0675:Akap12 UTSW 10 4353315 missense probably benign 0.06
R1248:Akap12 UTSW 10 4353847 missense probably benign 0.11
R1338:Akap12 UTSW 10 4313773 missense possibly damaging 0.95
R1448:Akap12 UTSW 10 4355475 missense probably benign 0.22
R1458:Akap12 UTSW 10 4353693 missense probably damaging 1.00
R1521:Akap12 UTSW 10 4354804 missense probably benign 0.02
R1585:Akap12 UTSW 10 4353640 missense probably benign 0.11
R1725:Akap12 UTSW 10 4353942 missense probably damaging 1.00
R1756:Akap12 UTSW 10 4357574 missense probably benign 0.04
R1914:Akap12 UTSW 10 4356685 missense probably benign 0.01
R1978:Akap12 UTSW 10 4313855 missense probably benign 0.06
R2032:Akap12 UTSW 10 4356673 missense possibly damaging 0.50
R2041:Akap12 UTSW 10 4356489 missense probably benign 0.01
R3009:Akap12 UTSW 10 4357891 missense probably benign 0.06
R3872:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3874:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3875:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3944:Akap12 UTSW 10 4357347 missense probably benign 0.00
R4612:Akap12 UTSW 10 4354456 missense probably damaging 1.00
R4889:Akap12 UTSW 10 4356535 missense probably damaging 0.97
R5043:Akap12 UTSW 10 4355047 missense probably damaging 1.00
R5176:Akap12 UTSW 10 4353947 missense probably benign 0.19
R5278:Akap12 UTSW 10 4354792 missense probably benign 0.02
R5320:Akap12 UTSW 10 4357291 missense probably benign 0.00
R5443:Akap12 UTSW 10 4355576 missense probably damaging 1.00
R5533:Akap12 UTSW 10 4357405 missense probably damaging 1.00
R6133:Akap12 UTSW 10 4355178 missense probably benign 0.05
R6142:Akap12 UTSW 10 4313740 splice site probably null
R6190:Akap12 UTSW 10 4356268 missense possibly damaging 0.92
R6458:Akap12 UTSW 10 4355148 missense probably damaging 1.00
R6562:Akap12 UTSW 10 4356141 nonsense probably null
R6701:Akap12 UTSW 10 4355243 missense probably damaging 1.00
R6828:Akap12 UTSW 10 4354606 missense probably damaging 0.96
R6991:Akap12 UTSW 10 4357122 nonsense probably null
R7023:Akap12 UTSW 10 4356895 missense probably benign 0.05
R7102:Akap12 UTSW 10 4353226 missense probably damaging 1.00
R7483:Akap12 UTSW 10 4353967 missense probably benign 0.00
R7538:Akap12 UTSW 10 4353213 missense probably damaging 1.00
R7664:Akap12 UTSW 10 4353748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTGGCATGCTAGATACG -3'
(R):5'- TCACTGTCTGTCAAGGTTTCAGATG -3'

Sequencing Primer
(F):5'- TGGCATGCTAGATACGGAAGAAC -3'
(R):5'- CTGTCAAGGTTTCAGATGACTCAG -3'
Posted On2019-11-12