Incidental Mutation 'R7704:Ddx21'
ID594194
Institutional Source Beutler Lab
Gene Symbol Ddx21
Ensembl Gene ENSMUSG00000020075
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 21
SynonymsD10Wsu42e, RH II/Gu, D10Ertd645e, RH-II/Gualpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7704 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location62580251-62602281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62594086 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 293 (Y293C)
Ref Sequence ENSEMBL: ENSMUSP00000042691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045866]
PDB Structure
Gu_alpha_helicase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045866
AA Change: Y293C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042691
Gene: ENSMUSG00000020075
AA Change: Y293C

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 107 139 N/A INTRINSIC
internal_repeat_1 140 160 2.96e-8 PROSPERO
low complexity region 162 171 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
internal_repeat_1 214 234 2.96e-8 PROSPERO
DEXDc 277 484 2.76e-56 SMART
HELICc 524 604 1.55e-27 SMART
low complexity region 682 688 N/A INTRINSIC
Pfam:GUCT 692 787 1.6e-33 PFAM
low complexity region 827 843 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an antigen recognized by autoimmune antibodies from a patient with watermelon stomach disease. This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,268,744 Q540K probably benign Het
Abcc8 C A 7: 46,106,644 W1458L probably damaging Het
Actn4 A T 7: 28,897,042 I676N possibly damaging Het
Adamts10 T C 17: 33,551,152 C1002R probably damaging Het
Agbl2 A C 2: 90,789,005 N58T probably benign Het
Akap12 A T 10: 4,356,082 D1069V probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Cfap65 T A 1: 74,928,368 T184S probably benign Het
Chd1 T C 17: 15,767,475 V1517A probably benign Het
CN725425 T A 15: 91,235,790 V38D possibly damaging Het
Copg1 T A 6: 87,907,958 L712Q probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Ddx46 C T 13: 55,674,019 P839S probably benign Het
Dennd5a A G 7: 109,896,967 V1164A possibly damaging Het
Dync1h1 T A 12: 110,665,766 I4490N probably damaging Het
Ecm1 A C 3: 95,736,531 Y236D probably damaging Het
Fam198a C T 9: 121,951,085 probably benign Het
Fat2 T C 11: 55,284,347 T1847A probably benign Het
Galc T A 12: 98,208,843 I567L probably benign Het
Gm4858 A G 3: 93,074,445 I183V probably benign Het
H6pd T C 4: 149,982,903 D350G probably benign Het
Ifi44 A G 3: 151,732,424 Y409H probably benign Het
Kdm5a T G 6: 120,427,064 F1210C probably damaging Het
Kdm5b C T 1: 134,587,931 R98C probably damaging Het
Lipt1 T A 1: 37,875,962 C366* probably null Het
Med13 G A 11: 86,345,918 R138* probably null Het
Mterf1a A G 5: 3,891,845 C8R probably benign Het
Ncapg2 A T 12: 116,419,277 I243F probably damaging Het
Nop58 T C 1: 59,705,595 S304P probably damaging Het
Nsd2 T C 5: 33,871,467 *167Q probably null Het
Olfr390 T G 11: 73,787,790 M284R probably damaging Het
Olfr597 T A 7: 103,320,771 M120K Het
Olfr721-ps1 T A 14: 14,407,867 I213N probably damaging Het
Prdm16 C T 4: 154,341,490 G613R probably damaging Het
Prss46 T C 9: 110,849,997 S89P probably damaging Het
Scin T C 12: 40,124,688 N132S possibly damaging Het
Sec14l2 T C 11: 4,108,574 K196R probably benign Het
Sox17 C A 1: 4,493,672 probably benign Het
Tango6 A G 8: 106,698,989 T394A probably benign Het
Tbc1d22a T A 15: 86,366,675 I398N probably damaging Het
Tmem8b T C 4: 43,689,461 V285A probably damaging Het
Tnfrsf11b T A 15: 54,260,101 T35S probably benign Het
Unc13c T A 9: 73,699,212 I1289F probably benign Het
Ust C T 10: 8,330,223 V99I probably benign Het
Vmn1r76 A G 7: 11,930,417 V290A probably benign Het
Vmn2r50 T C 7: 10,047,738 N360S probably benign Het
Vmn2r93 T C 17: 18,316,648 I531T probably benign Het
Zap70 T C 1: 36,779,314 probably null Het
Zfp932 A G 5: 110,009,764 N443D probably benign Het
Other mutations in Ddx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Ddx21 APN 10 62598402 nonsense probably null
IGL01144:Ddx21 APN 10 62598550 missense unknown
IGL01655:Ddx21 APN 10 62587491 missense probably damaging 0.98
IGL01694:Ddx21 APN 10 62598651 nonsense probably null
IGL01752:Ddx21 APN 10 62587507 missense probably damaging 1.00
IGL02827:Ddx21 APN 10 62598374 missense probably benign 0.04
IGL03140:Ddx21 APN 10 62594071 missense probably damaging 1.00
IGL03248:Ddx21 APN 10 62591990 missense possibly damaging 0.87
R0131:Ddx21 UTSW 10 62584752 missense possibly damaging 0.96
R0555:Ddx21 UTSW 10 62587528 missense probably damaging 1.00
R1437:Ddx21 UTSW 10 62598590 missense unknown
R1780:Ddx21 UTSW 10 62594147 splice site probably benign
R1875:Ddx21 UTSW 10 62594068 missense probably damaging 1.00
R2696:Ddx21 UTSW 10 62594092 missense possibly damaging 0.93
R4639:Ddx21 UTSW 10 62591837 nonsense probably null
R4678:Ddx21 UTSW 10 62594003 missense probably benign 0.06
R4767:Ddx21 UTSW 10 62591972 missense probably damaging 1.00
R4799:Ddx21 UTSW 10 62588121 missense probably damaging 0.98
R5145:Ddx21 UTSW 10 62587539 critical splice acceptor site probably null
R5243:Ddx21 UTSW 10 62602213 start codon destroyed probably null 0.02
R6085:Ddx21 UTSW 10 62594087 missense probably damaging 1.00
R6701:Ddx21 UTSW 10 62590691 missense probably damaging 1.00
R7134:Ddx21 UTSW 10 62591855 missense possibly damaging 0.95
R7517:Ddx21 UTSW 10 62588790 missense probably damaging 0.98
R7555:Ddx21 UTSW 10 62598243 missense probably benign 0.03
R7577:Ddx21 UTSW 10 62590670 missense probably benign 0.19
Z1177:Ddx21 UTSW 10 62587538 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTCAAAGATTCACCCCTGC -3'
(R):5'- GGACCACTAGTATGACTGTATGACTG -3'

Sequencing Primer
(F):5'- TGCCTATCTCAGATACACGGAG -3'
(R):5'- ACTGTATGACTGTATTAAAGTTGGGG -3'
Posted On2019-11-12