Incidental Mutation 'R7704:Chd1'
ID 594209
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
MMRRC Submission 045765-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7704 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 15925229-15992872 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15987737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1517 (V1517A)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627]
AlphaFold P40201
Predicted Effect probably benign
Transcript: ENSMUST00000024627
AA Change: V1517A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: V1517A

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,756,068 (GRCm39) W1458L probably damaging Het
Actn4 A T 7: 28,596,467 (GRCm39) I676N possibly damaging Het
Adamts10 T C 17: 33,770,126 (GRCm39) C1002R probably damaging Het
Agbl2 A C 2: 90,619,349 (GRCm39) N58T probably benign Het
Akap12 A T 10: 4,306,082 (GRCm39) D1069V probably damaging Het
Bltp2 C A 11: 78,159,570 (GRCm39) Q540K probably benign Het
Cfap65 T A 1: 74,967,527 (GRCm39) T184S probably benign Het
CN725425 T A 15: 91,119,993 (GRCm39) V38D possibly damaging Het
Copg1 T A 6: 87,884,940 (GRCm39) L712Q probably benign Het
Ctsf T G 19: 4,906,567 (GRCm39) F165V probably damaging Het
Ddx21 T C 10: 62,429,865 (GRCm39) Y293C probably damaging Het
Ddx46 C T 13: 55,821,832 (GRCm39) P839S probably benign Het
Dennd5a A G 7: 109,496,174 (GRCm39) V1164A possibly damaging Het
Dync1h1 T A 12: 110,632,200 (GRCm39) I4490N probably damaging Het
Ecm1 A C 3: 95,643,843 (GRCm39) Y236D probably damaging Het
Fat2 T C 11: 55,175,173 (GRCm39) T1847A probably benign Het
Galc T A 12: 98,175,102 (GRCm39) I567L probably benign Het
Gask1a C T 9: 121,780,151 (GRCm39) probably benign Het
H6pd T C 4: 150,067,360 (GRCm39) D350G probably benign Het
Ifi44 A G 3: 151,438,061 (GRCm39) Y409H probably benign Het
Kdm5a T G 6: 120,404,025 (GRCm39) F1210C probably damaging Het
Kdm5b C T 1: 134,515,669 (GRCm39) R98C probably damaging Het
Lipt1 T A 1: 37,915,043 (GRCm39) C366* probably null Het
Med13 G A 11: 86,236,744 (GRCm39) R138* probably null Het
Mterf1a A G 5: 3,941,845 (GRCm39) C8R probably benign Het
Ncapg2 A T 12: 116,382,897 (GRCm39) I243F probably damaging Het
Nop58 T C 1: 59,744,754 (GRCm39) S304P probably damaging Het
Nsd2 T C 5: 34,028,811 (GRCm39) *167Q probably null Het
Or1e30 T G 11: 73,678,616 (GRCm39) M284R probably damaging Het
Or2t35 T A 14: 14,407,867 (GRCm38) I213N probably damaging Het
Or52ab2 T A 7: 102,969,978 (GRCm39) M120K Het
Pramel29 C T 4: 143,935,091 (GRCm39) V217I possibly damaging Het
Prdm16 C T 4: 154,425,947 (GRCm39) G613R probably damaging Het
Prss46 T C 9: 110,679,065 (GRCm39) S89P probably damaging Het
Scin T C 12: 40,174,687 (GRCm39) N132S possibly damaging Het
Sec14l2 T C 11: 4,058,574 (GRCm39) K196R probably benign Het
Sox17 C A 1: 4,563,895 (GRCm39) probably benign Het
Tango6 A G 8: 107,425,621 (GRCm39) T394A probably benign Het
Tbc1d22a T A 15: 86,250,876 (GRCm39) I398N probably damaging Het
Tdpoz8 A G 3: 92,981,752 (GRCm39) I183V probably benign Het
Tmem8b T C 4: 43,689,461 (GRCm39) V285A probably damaging Het
Tnfrsf11b T A 15: 54,123,497 (GRCm39) T35S probably benign Het
Unc13c T A 9: 73,606,494 (GRCm39) I1289F probably benign Het
Ust C T 10: 8,205,987 (GRCm39) V99I probably benign Het
Vmn1r76 A G 7: 11,664,344 (GRCm39) V290A probably benign Het
Vmn2r50 T C 7: 9,781,665 (GRCm39) N360S probably benign Het
Vmn2r93 T C 17: 18,536,910 (GRCm39) I531T probably benign Het
Zap70 T C 1: 36,818,395 (GRCm39) probably null Het
Zfp932 A G 5: 110,157,630 (GRCm39) N443D probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15,952,827 (GRCm39) missense probably benign 0.37
IGL01356:Chd1 APN 17 15,970,127 (GRCm39) missense probably damaging 1.00
IGL01369:Chd1 APN 17 15,975,259 (GRCm39) missense probably damaging 0.97
IGL01519:Chd1 APN 17 17,598,831 (GRCm39) missense probably damaging 1.00
IGL01604:Chd1 APN 17 15,990,359 (GRCm39) missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17,598,858 (GRCm39) missense probably damaging 1.00
IGL01721:Chd1 APN 17 15,990,430 (GRCm39) missense probably damaging 1.00
IGL01959:Chd1 APN 17 15,962,435 (GRCm39) missense probably damaging 1.00
IGL02367:Chd1 APN 17 17,610,315 (GRCm39) missense probably damaging 0.98
IGL02476:Chd1 APN 17 15,954,535 (GRCm39) missense probably damaging 1.00
IGL02756:Chd1 APN 17 15,951,069 (GRCm39) missense probably damaging 0.97
IGL02817:Chd1 APN 17 15,969,762 (GRCm39) missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15,990,560 (GRCm39) missense probably benign 0.22
IGL03108:Chd1 APN 17 15,945,543 (GRCm39) missense possibly damaging 0.70
Holly UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0128:Chd1 UTSW 17 17,613,829 (GRCm39) missense probably damaging 1.00
R0197:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0285:Chd1 UTSW 17 17,594,942 (GRCm39) splice site probably benign
R0326:Chd1 UTSW 17 15,988,830 (GRCm39) missense probably benign
R0326:Chd1 UTSW 17 15,988,828 (GRCm39) missense probably damaging 1.00
R0372:Chd1 UTSW 17 17,607,552 (GRCm39) missense probably benign 0.14
R0391:Chd1 UTSW 17 15,970,156 (GRCm39) missense probably damaging 1.00
R0486:Chd1 UTSW 17 15,954,604 (GRCm39) missense probably damaging 0.99
R0637:Chd1 UTSW 17 15,962,550 (GRCm39) missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15,978,523 (GRCm39) unclassified probably benign
R0701:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0788:Chd1 UTSW 17 15,927,376 (GRCm39) missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15,990,503 (GRCm39) missense probably damaging 1.00
R0883:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R1169:Chd1 UTSW 17 15,955,994 (GRCm39) missense probably damaging 1.00
R1218:Chd1 UTSW 17 15,945,574 (GRCm39) missense probably damaging 1.00
R1370:Chd1 UTSW 17 17,607,742 (GRCm39) missense probably benign 0.00
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15,959,769 (GRCm39) missense probably damaging 0.99
R1752:Chd1 UTSW 17 15,963,494 (GRCm39) critical splice donor site probably null
R1759:Chd1 UTSW 17 17,607,533 (GRCm39) missense probably benign 0.00
R1767:Chd1 UTSW 17 15,990,565 (GRCm39) missense probably damaging 1.00
R1938:Chd1 UTSW 17 15,982,748 (GRCm39) missense probably benign 0.39
R2007:Chd1 UTSW 17 15,951,268 (GRCm39) missense probably damaging 1.00
R2069:Chd1 UTSW 17 15,962,556 (GRCm39) missense probably damaging 1.00
R3771:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3773:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3849:Chd1 UTSW 17 15,952,133 (GRCm39) missense probably damaging 1.00
R4241:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4242:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4354:Chd1 UTSW 17 17,610,263 (GRCm39) missense probably benign 0.23
R4468:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4469:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4731:Chd1 UTSW 17 17,598,079 (GRCm39) missense probably benign 0.36
R4824:Chd1 UTSW 17 15,953,386 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,016 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,015 (GRCm39) nonsense probably null
R4880:Chd1 UTSW 17 17,594,916 (GRCm39) missense probably damaging 1.00
R4960:Chd1 UTSW 17 15,962,493 (GRCm39) missense probably damaging 0.96
R5071:Chd1 UTSW 17 15,982,667 (GRCm39) missense probably benign
R5078:Chd1 UTSW 17 15,946,616 (GRCm39) missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15,948,460 (GRCm39) missense probably benign 0.25
R5268:Chd1 UTSW 17 15,956,005 (GRCm39) missense probably damaging 1.00
R5304:Chd1 UTSW 17 15,990,530 (GRCm39) missense possibly damaging 0.55
R5304:Chd1 UTSW 17 15,975,213 (GRCm39) missense probably benign 0.01
R5307:Chd1 UTSW 17 15,952,832 (GRCm39) missense probably damaging 1.00
R5458:Chd1 UTSW 17 15,958,811 (GRCm39) missense probably damaging 1.00
R5553:Chd1 UTSW 17 17,605,875 (GRCm39) missense probably benign 0.17
R5623:Chd1 UTSW 17 15,975,194 (GRCm39) missense probably damaging 1.00
R6022:Chd1 UTSW 17 17,598,035 (GRCm39) missense probably benign 0.39
R6137:Chd1 UTSW 17 15,978,950 (GRCm39) missense probably damaging 1.00
R6257:Chd1 UTSW 17 15,950,465 (GRCm39) splice site probably null
R6373:Chd1 UTSW 17 15,958,898 (GRCm39) missense probably damaging 1.00
R6458:Chd1 UTSW 17 15,950,864 (GRCm39) missense probably benign 0.01
R6476:Chd1 UTSW 17 17,601,250 (GRCm39) critical splice donor site probably null
R6508:Chd1 UTSW 17 15,958,895 (GRCm39) missense probably benign 0.31
R6553:Chd1 UTSW 17 15,945,692 (GRCm39) missense probably benign 0.00
R6745:Chd1 UTSW 17 17,607,429 (GRCm39) missense probably benign 0.08
R7107:Chd1 UTSW 17 15,981,628 (GRCm39) missense probably damaging 0.98
R7230:Chd1 UTSW 17 15,927,199 (GRCm39) splice site probably null
R7317:Chd1 UTSW 17 15,962,536 (GRCm39) missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15,990,499 (GRCm39) missense probably damaging 0.99
R7421:Chd1 UTSW 17 15,969,660 (GRCm39) missense probably benign 0.03
R7763:Chd1 UTSW 17 15,953,303 (GRCm39) missense probably damaging 1.00
R8156:Chd1 UTSW 17 15,981,666 (GRCm39) missense probably benign
R8194:Chd1 UTSW 17 17,594,737 (GRCm39) start gained probably benign
R8261:Chd1 UTSW 17 17,607,804 (GRCm39) missense probably benign 0.02
R8338:Chd1 UTSW 17 15,990,242 (GRCm39) missense probably damaging 1.00
R8401:Chd1 UTSW 17 15,963,473 (GRCm39) missense probably damaging 1.00
R8411:Chd1 UTSW 17 15,982,711 (GRCm39) missense probably damaging 0.98
R9067:Chd1 UTSW 17 15,951,107 (GRCm39) missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15,962,551 (GRCm39) missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9212:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9666:Chd1 UTSW 17 15,955,976 (GRCm39) missense probably damaging 1.00
R9673:Chd1 UTSW 17 15,989,023 (GRCm39) missense probably benign 0.24
Z1176:Chd1 UTSW 17 15,988,995 (GRCm39) missense probably damaging 1.00
Z1176:Chd1 UTSW 17 15,986,609 (GRCm39) missense probably damaging 0.98
Z1177:Chd1 UTSW 17 15,968,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGCACATGGTTTTCATCATC -3'
(R):5'- TCACACAGGCACATGTGACC -3'

Sequencing Primer
(F):5'- GGTTTTCATCATCTTCTTTGTCAAG -3'
(R):5'- GTGACCACACGCACACC -3'
Posted On 2019-11-12