Incidental Mutation 'R7705:Dytn'
ID594213
Institutional Source Beutler Lab
Gene Symbol Dytn
Ensembl Gene ENSMUSG00000069085
Gene Namedystrotelin
SynonymsLOC241073
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7705 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location63622851-63686927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63678789 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 29 (L29P)
Ref Sequence ENSEMBL: ENSMUSP00000087787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090313]
Predicted Effect probably damaging
Transcript: ENSMUST00000090313
AA Change: L29P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087787
Gene: ENSMUSG00000069085
AA Change: L29P

DomainStartEndE-ValueType
Pfam:EF-hand_2 5 118 8.2e-14 PFAM
Pfam:EF-hand_3 123 217 7.2e-20 PFAM
ZnF_ZZ 222 267 7.34e-13 SMART
coiled coil region 382 411 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,182,252 F359V probably damaging Het
Abcb9 G T 5: 124,081,955 Y342* probably null Het
Acad9 C T 3: 36,088,526 T470M probably benign Het
Ankmy2 A G 12: 36,195,108 E379G probably benign Het
Cand1 A G 10: 119,212,438 probably null Het
Ccdc171 A G 4: 83,557,956 T203A possibly damaging Het
Cpeb4 A G 11: 31,872,327 T14A probably damaging Het
Crtap A T 9: 114,381,679 C276S probably damaging Het
Csf2rb2 T C 15: 78,284,574 I794V probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T A 5: 121,869,673 M642L probably benign Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
E2f3 G A 13: 29,985,323 R116C probably benign Het
Edc3 T C 9: 57,739,914 V282A probably benign Het
Epha1 A G 6: 42,362,668 V630A probably damaging Het
Erc1 A G 6: 119,824,603 I151T probably benign Het
Fam83h C T 15: 76,003,850 R546H probably damaging Het
Fbxl14 A T 6: 119,480,781 K308* probably null Het
Gldn T A 9: 54,338,692 M509K probably benign Het
Gm14085 A C 2: 122,521,629 probably null Het
Gm4969 T A 7: 19,101,119 D393V unknown Het
Gm8298 G A 3: 59,876,747 A214T probably benign Het
Gpr139 T C 7: 119,144,643 I240V probably benign Het
Herc1 G T 9: 66,439,834 M1990I possibly damaging Het
Hmgcr A G 13: 96,656,723 I467T probably benign Het
Isl2 T C 9: 55,542,401 F85L probably benign Het
Lat T C 7: 126,364,440 N197D probably damaging Het
March1 T C 8: 66,468,517 V282A probably benign Het
Mrpl9 A G 3: 94,443,768 H85R possibly damaging Het
Mterf2 G T 10: 85,120,517 A81E probably damaging Het
Mtr A G 13: 12,249,896 C107R probably benign Het
Nlrp4c T A 7: 6,072,636 V642E probably damaging Het
Olfr1445 A G 19: 12,884,507 I209V probably benign Het
Olfr805 T A 10: 129,723,149 I132F probably benign Het
Pdik1l A G 4: 134,279,493 S112P unknown Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Rest T A 5: 77,268,272 L111Q probably damaging Het
Spg7 A C 8: 123,073,878 D169A possibly damaging Het
Syt3 T C 7: 44,392,659 V314A possibly damaging Het
Tbc1d20 G C 2: 152,308,084 G144R probably damaging Het
Tmem147 T G 7: 30,728,291 probably null Het
Trip12 A T 1: 84,777,449 D401E probably damaging Het
Ulbp1 A G 10: 7,445,685 S291P unknown Het
Usp19 A G 9: 108,501,913 D1286G possibly damaging Het
Usp49 T C 17: 47,678,948 F553L probably damaging Het
Zfp352 A G 4: 90,225,275 T551A possibly damaging Het
Other mutations in Dytn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dytn APN 1 63678840 missense probably benign 0.34
IGL00870:Dytn APN 1 63677113 splice site probably benign
IGL02110:Dytn APN 1 63647473 missense possibly damaging 0.86
IGL02124:Dytn APN 1 63641092 missense probably damaging 1.00
IGL02211:Dytn APN 1 63674930 missense possibly damaging 0.61
IGL02712:Dytn APN 1 63664422 missense probably benign 0.00
IGL02832:Dytn APN 1 63643373 missense probably benign 0.45
IGL03036:Dytn APN 1 63641122 missense probably damaging 0.97
H8562:Dytn UTSW 1 63674912 missense possibly damaging 0.88
R0306:Dytn UTSW 1 63685113 missense possibly damaging 0.89
R0441:Dytn UTSW 1 63678774 splice site probably benign
R1453:Dytn UTSW 1 63633873 missense probably damaging 0.99
R1655:Dytn UTSW 1 63661198 missense probably damaging 1.00
R1892:Dytn UTSW 1 63677261 missense probably benign 0.04
R3030:Dytn UTSW 1 63633519 missense probably benign 0.04
R4062:Dytn UTSW 1 63647447 missense probably benign 0.05
R4640:Dytn UTSW 1 63643348 missense possibly damaging 0.52
R4804:Dytn UTSW 1 63643366 missense probably benign 0.08
R4931:Dytn UTSW 1 63633678 missense probably benign 0.26
R5015:Dytn UTSW 1 63633695 missense probably benign 0.00
R5054:Dytn UTSW 1 63661159 missense possibly damaging 0.64
R5120:Dytn UTSW 1 63623043 missense probably benign
R5888:Dytn UTSW 1 63677237 missense possibly damaging 0.91
R6243:Dytn UTSW 1 63647521 missense possibly damaging 0.76
R6400:Dytn UTSW 1 63641176 nonsense probably null
R7595:Dytn UTSW 1 63659002 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTATTGCTGTCAGTGAAGCAAC -3'
(R):5'- GTCTCACTTACAAGGTGAGGCTC -3'

Sequencing Primer
(F):5'- AGTGGACTGCTCACAATGGTCTC -3'
(R):5'- CACTTACAAGGTGAGGCTCTAGGAG -3'
Posted On2019-11-12