Incidental Mutation 'R7705:Pex19'
ID 594215
Institutional Source Beutler Lab
Gene Symbol Pex19
Ensembl Gene ENSMUSG00000003464
Gene Name peroxisomal biogenesis factor 19
Synonyms peroxisome biogenesis factor 19, Pxf
MMRRC Submission 045766-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.761) question?
Stock # R7705 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 171954322-171964060 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC at 171956150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075895] [ENSMUST00000111252]
AlphaFold Q8VCI5
Predicted Effect probably null
Transcript: ENSMUST00000075895
SMART Domains Protein: ENSMUSP00000075289
Gene: ENSMUSG00000003464

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Pex19 74 299 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111252
SMART Domains Protein: ENSMUSP00000106883
Gene: ENSMUSG00000003464

DomainStartEndE-ValueType
Pfam:Pex19 9 207 5.7e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is necessary for early peroxisomal biogenesis. It acts both as a cytosolic chaperone and as an import receptor for peroxisomal membrane proteins (PMPs). Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. These disorders have at least 14 complementation groups, with more than one phenotype being observed for some complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of Zellweger syndrome (ZWS), as well as peroxisome biogenesis disorder complementation group 14 (PBD-CG14), which is also known as PBD-CGJ. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 G A 3: 59,784,168 (GRCm39) A214T probably benign Het
Abcb9 G T 5: 124,220,018 (GRCm39) Y342* probably null Het
Acad9 C T 3: 36,142,675 (GRCm39) T470M probably benign Het
Ankmy2 A G 12: 36,245,107 (GRCm39) E379G probably benign Het
Cand1 A G 10: 119,048,343 (GRCm39) probably null Het
Ccdc171 A G 4: 83,476,193 (GRCm39) T203A possibly damaging Het
Cpeb4 A G 11: 31,822,327 (GRCm39) T14A probably damaging Het
Cplane1 T G 15: 8,211,736 (GRCm39) F359V probably damaging Het
Crtap A T 9: 114,210,747 (GRCm39) C276S probably damaging Het
Csf2rb2 T C 15: 78,168,774 (GRCm39) I794V probably benign Het
Ctsf T G 19: 4,906,567 (GRCm39) F165V probably damaging Het
Cux2 T A 5: 122,007,736 (GRCm39) M642L probably benign Het
Dpep1 T C 8: 123,927,460 (GRCm39) V338A possibly damaging Het
Dytn A G 1: 63,717,948 (GRCm39) L29P probably damaging Het
E2f3 G A 13: 30,169,306 (GRCm39) R116C probably benign Het
Edc3 T C 9: 57,647,197 (GRCm39) V282A probably benign Het
Epha1 A G 6: 42,339,602 (GRCm39) V630A probably damaging Het
Erc1 A G 6: 119,801,564 (GRCm39) I151T probably benign Het
Fam83h C T 15: 75,875,699 (GRCm39) R546H probably damaging Het
Fbxl14 A T 6: 119,457,742 (GRCm39) K308* probably null Het
Fbxw24 A T 9: 109,437,516 (GRCm39) probably null Het
Gldn T A 9: 54,245,976 (GRCm39) M509K probably benign Het
Gpr139 T C 7: 118,743,866 (GRCm39) I240V probably benign Het
Herc1 G T 9: 66,347,116 (GRCm39) M1990I possibly damaging Het
Hmgcr A G 13: 96,793,231 (GRCm39) I467T probably benign Het
Isl2 T C 9: 55,449,685 (GRCm39) F85L probably benign Het
Lat T C 7: 125,963,612 (GRCm39) N197D probably damaging Het
Marchf1 T C 8: 66,921,169 (GRCm39) V282A probably benign Het
Meiosin T A 7: 18,835,044 (GRCm39) D393V unknown Het
Mrpl9 A G 3: 94,351,075 (GRCm39) H85R possibly damaging Het
Mterf2 G T 10: 84,956,381 (GRCm39) A81E probably damaging Het
Mtr A G 13: 12,264,782 (GRCm39) C107R probably benign Het
Nlrp4c T A 7: 6,075,635 (GRCm39) V642E probably damaging Het
Or5b12b A G 19: 12,861,871 (GRCm39) I209V probably benign Het
Or6c212 T A 10: 129,559,018 (GRCm39) I132F probably benign Het
Pdik1l A G 4: 134,006,804 (GRCm39) S112P unknown Het
Rest T A 5: 77,416,119 (GRCm39) L111Q probably damaging Het
Slc28a2b A C 2: 122,352,110 (GRCm39) probably null Het
Spg7 A C 8: 123,800,617 (GRCm39) D169A possibly damaging Het
Syt3 T C 7: 44,042,083 (GRCm39) V314A possibly damaging Het
Tbc1d20 G C 2: 152,150,004 (GRCm39) G144R probably damaging Het
Tlk1 A T 2: 70,617,016 (GRCm39) probably null Het
Tmem147 T G 7: 30,427,716 (GRCm39) probably null Het
Trip12 A T 1: 84,755,170 (GRCm39) D401E probably damaging Het
Ulbp1 A G 10: 7,395,685 (GRCm39) S291P unknown Het
Usp19 A G 9: 108,379,112 (GRCm39) D1286G possibly damaging Het
Usp49 T C 17: 47,989,873 (GRCm39) F553L probably damaging Het
Zfp352 A G 4: 90,113,512 (GRCm39) T551A possibly damaging Het
Other mutations in Pex19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Pex19 APN 1 171,961,853 (GRCm39) missense probably damaging 1.00
IGL02656:Pex19 APN 1 171,958,252 (GRCm39) missense probably benign 0.11
R5457:Pex19 UTSW 1 171,958,245 (GRCm39) missense probably damaging 1.00
R5590:Pex19 UTSW 1 171,960,779 (GRCm39) missense probably benign 0.00
R5809:Pex19 UTSW 1 171,958,306 (GRCm39) missense probably damaging 0.98
R6148:Pex19 UTSW 1 171,961,606 (GRCm39) missense probably damaging 0.96
R7088:Pex19 UTSW 1 171,956,150 (GRCm39) frame shift probably null
R7854:Pex19 UTSW 1 171,954,417 (GRCm39) critical splice donor site probably null
R9017:Pex19 UTSW 1 171,956,150 (GRCm39) frame shift probably null
R9018:Pex19 UTSW 1 171,956,150 (GRCm39) frame shift probably null
R9152:Pex19 UTSW 1 171,956,150 (GRCm39) frame shift probably null
R9243:Pex19 UTSW 1 171,956,150 (GRCm39) frame shift probably null
R9781:Pex19 UTSW 1 171,956,855 (GRCm39) missense probably damaging 1.00
Predicted Primers
Posted On 2019-11-12