Incidental Mutation 'R7705:Gm14085'
ID594216
Institutional Source Beutler Lab
Gene Symbol Gm14085
Ensembl Gene ENSMUSG00000079071
Gene Namepredicted gene 14085
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7705 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122484941-122528040 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to C at 122521629 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521] [ENSMUST00000110521] [ENSMUST00000110521]
Predicted Effect probably null
Transcript: ENSMUST00000110521
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110521
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110521
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,182,252 F359V probably damaging Het
Abcb9 G T 5: 124,081,955 Y342* probably null Het
Acad9 C T 3: 36,088,526 T470M probably benign Het
Ankmy2 A G 12: 36,195,108 E379G probably benign Het
Cand1 A G 10: 119,212,438 probably null Het
Ccdc171 A G 4: 83,557,956 T203A possibly damaging Het
Cpeb4 A G 11: 31,872,327 T14A probably damaging Het
Crtap A T 9: 114,381,679 C276S probably damaging Het
Csf2rb2 T C 15: 78,284,574 I794V probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T A 5: 121,869,673 M642L probably benign Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Dytn A G 1: 63,678,789 L29P probably damaging Het
E2f3 G A 13: 29,985,323 R116C probably benign Het
Edc3 T C 9: 57,739,914 V282A probably benign Het
Epha1 A G 6: 42,362,668 V630A probably damaging Het
Erc1 A G 6: 119,824,603 I151T probably benign Het
Fam83h C T 15: 76,003,850 R546H probably damaging Het
Fbxl14 A T 6: 119,480,781 K308* probably null Het
Fbxw24 A T 9: 109,608,448 probably null Het
Gldn T A 9: 54,338,692 M509K probably benign Het
Gm4969 T A 7: 19,101,119 D393V unknown Het
Gm8298 G A 3: 59,876,747 A214T probably benign Het
Gpr139 T C 7: 119,144,643 I240V probably benign Het
Herc1 G T 9: 66,439,834 M1990I possibly damaging Het
Hmgcr A G 13: 96,656,723 I467T probably benign Het
Isl2 T C 9: 55,542,401 F85L probably benign Het
Lat T C 7: 126,364,440 N197D probably damaging Het
March1 T C 8: 66,468,517 V282A probably benign Het
Mrpl9 A G 3: 94,443,768 H85R possibly damaging Het
Mterf2 G T 10: 85,120,517 A81E probably damaging Het
Mtr A G 13: 12,249,896 C107R probably benign Het
Nlrp4c T A 7: 6,072,636 V642E probably damaging Het
Olfr1445 A G 19: 12,884,507 I209V probably benign Het
Olfr805 T A 10: 129,723,149 I132F probably benign Het
Pdik1l A G 4: 134,279,493 S112P unknown Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Rest T A 5: 77,268,272 L111Q probably damaging Het
Spg7 A C 8: 123,073,878 D169A possibly damaging Het
Syt3 T C 7: 44,392,659 V314A possibly damaging Het
Tbc1d20 G C 2: 152,308,084 G144R probably damaging Het
Tlk1 A T 2: 70,786,672 probably null Het
Tmem147 T G 7: 30,728,291 probably null Het
Trip12 A T 1: 84,777,449 D401E probably damaging Het
Ulbp1 A G 10: 7,445,685 S291P unknown Het
Usp19 A G 9: 108,501,913 D1286G possibly damaging Het
Usp49 T C 17: 47,678,948 F553L probably damaging Het
Zfp352 A G 4: 90,225,275 T551A possibly damaging Het
Other mutations in Gm14085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Gm14085 APN 2 122517046 missense probably damaging 0.98
IGL01160:Gm14085 APN 2 122524796 critical splice acceptor site probably null
IGL01838:Gm14085 APN 2 122517983 missense possibly damaging 0.65
IGL01895:Gm14085 APN 2 122525091 missense possibly damaging 0.75
IGL02999:Gm14085 APN 2 122514514 splice site probably benign
Wilted UTSW 2 122523482 missense probably damaging 1.00
K2124:Gm14085 UTSW 2 122525153 missense probably benign 0.00
R0084:Gm14085 UTSW 2 122522833 missense possibly damaging 0.95
R0092:Gm14085 UTSW 2 122517597 splice site probably benign
R0127:Gm14085 UTSW 2 122517069 critical splice donor site probably null
R0200:Gm14085 UTSW 2 122527447 makesense probably null
R0276:Gm14085 UTSW 2 122521928 missense probably damaging 1.00
R0309:Gm14085 UTSW 2 122517553 missense probably benign 0.04
R0403:Gm14085 UTSW 2 122521854 missense probably damaging 1.00
R0600:Gm14085 UTSW 2 122514398 missense probably damaging 0.97
R0612:Gm14085 UTSW 2 122521698 missense probably damaging 1.00
R1676:Gm14085 UTSW 2 122521859 missense probably damaging 0.99
R1801:Gm14085 UTSW 2 122521652 missense possibly damaging 0.57
R1986:Gm14085 UTSW 2 122527429 missense probably benign 0.00
R2050:Gm14085 UTSW 2 122522868 missense probably benign 0.21
R3078:Gm14085 UTSW 2 122514414 missense possibly damaging 0.63
R4075:Gm14085 UTSW 2 122514411 missense probably benign 0.00
R4096:Gm14085 UTSW 2 122522728 missense probably damaging 1.00
R4744:Gm14085 UTSW 2 122522805 nonsense probably null
R4796:Gm14085 UTSW 2 122514459 missense probably damaging 0.99
R5033:Gm14085 UTSW 2 122522914 critical splice donor site probably null
R5069:Gm14085 UTSW 2 122494373 missense possibly damaging 0.93
R5288:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5385:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5386:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5442:Gm14085 UTSW 2 122486869 missense probably benign
R5795:Gm14085 UTSW 2 122517994 missense possibly damaging 0.79
R6258:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6260:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6383:Gm14085 UTSW 2 122524807 missense probably benign 0.00
R7226:Gm14085 UTSW 2 122522532 missense probably benign 0.00
R7574:Gm14085 UTSW 2 122522844 missense not run
R7633:Gm14085 UTSW 2 122486680 missense probably null 0.05
R7726:Gm14085 UTSW 2 122486733 missense probably damaging 0.99
R7998:Gm14085 UTSW 2 122494358 missense probably damaging 0.97
R8269:Gm14085 UTSW 2 122521688 missense probably damaging 1.00
R8337:Gm14085 UTSW 2 122525136 missense probably benign 0.06
R8546:Gm14085 UTSW 2 122522754 missense probably benign 0.14
R8817:Gm14085 UTSW 2 122518507 missense possibly damaging 0.95
R8931:Gm14085 UTSW 2 122518502 missense
Predicted Primers PCR Primer
(F):5'- CACTAAGTGCATGGATATAGGCAG -3'
(R):5'- ACATGAGTGCACCATGAGC -3'

Sequencing Primer
(F):5'- TGCATGGATATAGGCAGGGTAAAC -3'
(R):5'- GAGCAATTATGTTGACTGTGCCTCAC -3'
Posted On2019-11-12