Incidental Mutation 'R7705:Gm8298'
ID594219
Institutional Source Beutler Lab
Gene Symbol Gm8298
Ensembl Gene ENSMUSG00000095522
Gene Namepredicted gene 8298
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7705 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location59861051-59877313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59876747 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 214 (A214T)
Ref Sequence ENSEMBL: ENSMUSP00000137307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179799]
Predicted Effect probably benign
Transcript: ENSMUST00000179799
AA Change: A214T

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137307
Gene: ENSMUSG00000095522
AA Change: A214T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:COesterase 91 217 9.6e-7 PFAM
Pfam:Abhydrolase_3 107 279 1.1e-36 PFAM
Pfam:Abhydrolase_3 284 375 1.2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,182,252 F359V probably damaging Het
Abcb9 G T 5: 124,081,955 Y342* probably null Het
Acad9 C T 3: 36,088,526 T470M probably benign Het
Ankmy2 A G 12: 36,195,108 E379G probably benign Het
Cand1 A G 10: 119,212,438 probably null Het
Ccdc171 A G 4: 83,557,956 T203A possibly damaging Het
Cpeb4 A G 11: 31,872,327 T14A probably damaging Het
Crtap A T 9: 114,381,679 C276S probably damaging Het
Csf2rb2 T C 15: 78,284,574 I794V probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T A 5: 121,869,673 M642L probably benign Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Dytn A G 1: 63,678,789 L29P probably damaging Het
E2f3 G A 13: 29,985,323 R116C probably benign Het
Edc3 T C 9: 57,739,914 V282A probably benign Het
Epha1 A G 6: 42,362,668 V630A probably damaging Het
Erc1 A G 6: 119,824,603 I151T probably benign Het
Fam83h C T 15: 76,003,850 R546H probably damaging Het
Fbxl14 A T 6: 119,480,781 K308* probably null Het
Fbxw24 A T 9: 109,608,448 probably null Het
Gldn T A 9: 54,338,692 M509K probably benign Het
Gm14085 A C 2: 122,521,629 probably null Het
Gm4969 T A 7: 19,101,119 D393V unknown Het
Gpr139 T C 7: 119,144,643 I240V probably benign Het
Herc1 G T 9: 66,439,834 M1990I possibly damaging Het
Hmgcr A G 13: 96,656,723 I467T probably benign Het
Isl2 T C 9: 55,542,401 F85L probably benign Het
Lat T C 7: 126,364,440 N197D probably damaging Het
March1 T C 8: 66,468,517 V282A probably benign Het
Mrpl9 A G 3: 94,443,768 H85R possibly damaging Het
Mterf2 G T 10: 85,120,517 A81E probably damaging Het
Mtr A G 13: 12,249,896 C107R probably benign Het
Nlrp4c T A 7: 6,072,636 V642E probably damaging Het
Olfr1445 A G 19: 12,884,507 I209V probably benign Het
Olfr805 T A 10: 129,723,149 I132F probably benign Het
Pdik1l A G 4: 134,279,493 S112P unknown Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Rest T A 5: 77,268,272 L111Q probably damaging Het
Spg7 A C 8: 123,073,878 D169A possibly damaging Het
Syt3 T C 7: 44,392,659 V314A possibly damaging Het
Tbc1d20 G C 2: 152,308,084 G144R probably damaging Het
Tlk1 A T 2: 70,786,672 probably null Het
Tmem147 T G 7: 30,728,291 probably null Het
Trip12 A T 1: 84,777,449 D401E probably damaging Het
Ulbp1 A G 10: 7,445,685 S291P unknown Het
Usp19 A G 9: 108,501,913 D1286G possibly damaging Het
Usp49 T C 17: 47,678,948 F553L probably damaging Het
Zfp352 A G 4: 90,225,275 T551A possibly damaging Het
Other mutations in Gm8298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gm8298 APN 3 59868900 missense possibly damaging 0.80
IGL02064:Gm8298 APN 3 59877042 missense probably damaging 1.00
IGL02317:Gm8298 APN 3 59876987 missense probably benign 0.00
R0270:Gm8298 UTSW 3 59877019 missense probably benign
R0580:Gm8298 UTSW 3 59877049 missense probably damaging 1.00
R1124:Gm8298 UTSW 3 59865218 missense probably benign 0.39
R1208:Gm8298 UTSW 3 59865294 missense probably benign 0.27
R1222:Gm8298 UTSW 3 59877261 nonsense probably null
R1436:Gm8298 UTSW 3 59865339 missense probably damaging 0.98
R1529:Gm8298 UTSW 3 59861112 missense probably benign
R1806:Gm8298 UTSW 3 59877150 missense probably damaging 1.00
R2130:Gm8298 UTSW 3 59865348 missense probably damaging 1.00
R4209:Gm8298 UTSW 3 59877156 missense probably damaging 1.00
R4597:Gm8298 UTSW 3 59876793 missense possibly damaging 0.47
R4910:Gm8298 UTSW 3 59869014 critical splice donor site probably null
R5571:Gm8298 UTSW 3 59877219 missense probably damaging 1.00
R6131:Gm8298 UTSW 3 59868903 missense possibly damaging 0.76
R6447:Gm8298 UTSW 3 59865398 missense probably damaging 0.99
R6481:Gm8298 UTSW 3 59861057 missense probably benign 0.00
R6795:Gm8298 UTSW 3 59868936 missense probably damaging 1.00
R7092:Gm8298 UTSW 3 59861079 missense probably benign 0.41
R7334:Gm8298 UTSW 3 59868959 missense probably damaging 1.00
R7602:Gm8298 UTSW 3 59877276 missense probably benign 0.17
R7660:Gm8298 UTSW 3 59865268 missense probably benign 0.05
R7708:Gm8298 UTSW 3 59865335 missense probably benign 0.00
R8167:Gm8298 UTSW 3 59877211 missense probably benign 0.03
X0011:Gm8298 UTSW 3 59861177 missense probably benign
X0022:Gm8298 UTSW 3 59877024 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCACTTTCTCACTGAAGAAGATG -3'
(R):5'- ACAAATGTCTTGACTCTTGAGGTAC -3'

Sequencing Primer
(F):5'- CTCACTGAAGAAGATGAATGATGTTC -3'
(R):5'- CTCTTGAGGTACATGAGCATTTC -3'
Posted On2019-11-12