Incidental Mutation 'R7705:Zfp352'
ID 594222
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Name zinc finger protein 352
Synonyms 2czf48
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7705 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 90218820-90225702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90225275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 551 (T551A)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
AlphaFold A2AML7
Predicted Effect possibly damaging
Transcript: ENSMUST00000080541
AA Change: T551A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: T551A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107129
AA Change: T551A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: T551A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,182,252 F359V probably damaging Het
Abcb9 G T 5: 124,081,955 Y342* probably null Het
Acad9 C T 3: 36,088,526 T470M probably benign Het
Ankmy2 A G 12: 36,195,108 E379G probably benign Het
Cand1 A G 10: 119,212,438 probably null Het
Ccdc171 A G 4: 83,557,956 T203A possibly damaging Het
Cpeb4 A G 11: 31,872,327 T14A probably damaging Het
Crtap A T 9: 114,381,679 C276S probably damaging Het
Csf2rb2 T C 15: 78,284,574 I794V probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T A 5: 121,869,673 M642L probably benign Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Dytn A G 1: 63,678,789 L29P probably damaging Het
E2f3 G A 13: 29,985,323 R116C probably benign Het
Edc3 T C 9: 57,739,914 V282A probably benign Het
Epha1 A G 6: 42,362,668 V630A probably damaging Het
Erc1 A G 6: 119,824,603 I151T probably benign Het
Fam83h C T 15: 76,003,850 R546H probably damaging Het
Fbxl14 A T 6: 119,480,781 K308* probably null Het
Fbxw24 A T 9: 109,608,448 probably null Het
Gldn T A 9: 54,338,692 M509K probably benign Het
Gm14085 A C 2: 122,521,629 probably null Het
Gm4969 T A 7: 19,101,119 D393V unknown Het
Gm8298 G A 3: 59,876,747 A214T probably benign Het
Gpr139 T C 7: 119,144,643 I240V probably benign Het
Herc1 G T 9: 66,439,834 M1990I possibly damaging Het
Hmgcr A G 13: 96,656,723 I467T probably benign Het
Isl2 T C 9: 55,542,401 F85L probably benign Het
Lat T C 7: 126,364,440 N197D probably damaging Het
March1 T C 8: 66,468,517 V282A probably benign Het
Mrpl9 A G 3: 94,443,768 H85R possibly damaging Het
Mterf2 G T 10: 85,120,517 A81E probably damaging Het
Mtr A G 13: 12,249,896 C107R probably benign Het
Nlrp4c T A 7: 6,072,636 V642E probably damaging Het
Olfr1445 A G 19: 12,884,507 I209V probably benign Het
Olfr805 T A 10: 129,723,149 I132F probably benign Het
Pdik1l A G 4: 134,279,493 S112P unknown Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Rest T A 5: 77,268,272 L111Q probably damaging Het
Spg7 A C 8: 123,073,878 D169A possibly damaging Het
Syt3 T C 7: 44,392,659 V314A possibly damaging Het
Tbc1d20 G C 2: 152,308,084 G144R probably damaging Het
Tlk1 A T 2: 70,786,672 probably null Het
Tmem147 T G 7: 30,728,291 probably null Het
Trip12 A T 1: 84,777,449 D401E probably damaging Het
Ulbp1 A G 10: 7,445,685 S291P unknown Het
Usp19 A G 9: 108,501,913 D1286G possibly damaging Het
Usp49 T C 17: 47,678,948 F553L probably damaging Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90224154 missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90224130 missense probably benign 0.02
IGL03156:Zfp352 APN 4 90224087 missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90224702 missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90223757 missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90224346 missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90224285 missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90225009 missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90224690 missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90223919 missense probably benign
R1034:Zfp352 UTSW 4 90224156 missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90223809 missense probably benign 0.23
R2016:Zfp352 UTSW 4 90225171 missense probably benign 0.42
R2064:Zfp352 UTSW 4 90225120 missense probably benign 0.08
R2308:Zfp352 UTSW 4 90225243 missense probably benign 0.00
R3552:Zfp352 UTSW 4 90225102 missense probably benign 0.33
R3794:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90225024 missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90223834 missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90225164 missense probably benign 0.00
R4590:Zfp352 UTSW 4 90224535 missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4617:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4618:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4741:Zfp352 UTSW 4 90224940 missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90224304 missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R4973:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R5167:Zfp352 UTSW 4 90224216 missense possibly damaging 0.94
R5260:Zfp352 UTSW 4 90224460 missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90225104 missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90225070 missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90225200 missense probably benign 0.33
R6819:Zfp352 UTSW 4 90224699 missense probably benign
R7072:Zfp352 UTSW 4 90224424 missense probably benign 0.00
R7099:Zfp352 UTSW 4 90224880 missense probably benign 0.00
R7569:Zfp352 UTSW 4 90223659 missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90224777 missense probably benign 0.13
R8424:Zfp352 UTSW 4 90224243 missense possibly damaging 0.87
R9180:Zfp352 UTSW 4 90224881 missense probably benign 0.38
R9378:Zfp352 UTSW 4 90224338 missense probably benign 0.13
R9509:Zfp352 UTSW 4 90224706 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATACGGGTGTGATGAGCCTG -3'
(R):5'- AGTCACAAGTCTGACCCCAG -3'

Sequencing Primer
(F):5'- ATGAGCCTGGGTGCACATG -3'
(R):5'- AGCTCTGCACATTCTGGACAG -3'
Posted On 2019-11-12