Incidental Mutation 'R7705:Zfp352'
ID 594222
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Name zinc finger protein 352
Synonyms 2czf48
MMRRC Submission 045766-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7705 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 90107057-90113924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90113512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 551 (T551A)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
AlphaFold A2AML7
Predicted Effect possibly damaging
Transcript: ENSMUST00000080541
AA Change: T551A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: T551A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107129
AA Change: T551A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: T551A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 G A 3: 59,784,168 (GRCm39) A214T probably benign Het
Abcb9 G T 5: 124,220,018 (GRCm39) Y342* probably null Het
Acad9 C T 3: 36,142,675 (GRCm39) T470M probably benign Het
Ankmy2 A G 12: 36,245,107 (GRCm39) E379G probably benign Het
Cand1 A G 10: 119,048,343 (GRCm39) probably null Het
Ccdc171 A G 4: 83,476,193 (GRCm39) T203A possibly damaging Het
Cpeb4 A G 11: 31,822,327 (GRCm39) T14A probably damaging Het
Cplane1 T G 15: 8,211,736 (GRCm39) F359V probably damaging Het
Crtap A T 9: 114,210,747 (GRCm39) C276S probably damaging Het
Csf2rb2 T C 15: 78,168,774 (GRCm39) I794V probably benign Het
Ctsf T G 19: 4,906,567 (GRCm39) F165V probably damaging Het
Cux2 T A 5: 122,007,736 (GRCm39) M642L probably benign Het
Dpep1 T C 8: 123,927,460 (GRCm39) V338A possibly damaging Het
Dytn A G 1: 63,717,948 (GRCm39) L29P probably damaging Het
E2f3 G A 13: 30,169,306 (GRCm39) R116C probably benign Het
Edc3 T C 9: 57,647,197 (GRCm39) V282A probably benign Het
Epha1 A G 6: 42,339,602 (GRCm39) V630A probably damaging Het
Erc1 A G 6: 119,801,564 (GRCm39) I151T probably benign Het
Fam83h C T 15: 75,875,699 (GRCm39) R546H probably damaging Het
Fbxl14 A T 6: 119,457,742 (GRCm39) K308* probably null Het
Fbxw24 A T 9: 109,437,516 (GRCm39) probably null Het
Gldn T A 9: 54,245,976 (GRCm39) M509K probably benign Het
Gpr139 T C 7: 118,743,866 (GRCm39) I240V probably benign Het
Herc1 G T 9: 66,347,116 (GRCm39) M1990I possibly damaging Het
Hmgcr A G 13: 96,793,231 (GRCm39) I467T probably benign Het
Isl2 T C 9: 55,449,685 (GRCm39) F85L probably benign Het
Lat T C 7: 125,963,612 (GRCm39) N197D probably damaging Het
Marchf1 T C 8: 66,921,169 (GRCm39) V282A probably benign Het
Meiosin T A 7: 18,835,044 (GRCm39) D393V unknown Het
Mrpl9 A G 3: 94,351,075 (GRCm39) H85R possibly damaging Het
Mterf2 G T 10: 84,956,381 (GRCm39) A81E probably damaging Het
Mtr A G 13: 12,264,782 (GRCm39) C107R probably benign Het
Nlrp4c T A 7: 6,075,635 (GRCm39) V642E probably damaging Het
Or5b12b A G 19: 12,861,871 (GRCm39) I209V probably benign Het
Or6c212 T A 10: 129,559,018 (GRCm39) I132F probably benign Het
Pdik1l A G 4: 134,006,804 (GRCm39) S112P unknown Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Rest T A 5: 77,416,119 (GRCm39) L111Q probably damaging Het
Slc28a2b A C 2: 122,352,110 (GRCm39) probably null Het
Spg7 A C 8: 123,800,617 (GRCm39) D169A possibly damaging Het
Syt3 T C 7: 44,042,083 (GRCm39) V314A possibly damaging Het
Tbc1d20 G C 2: 152,150,004 (GRCm39) G144R probably damaging Het
Tlk1 A T 2: 70,617,016 (GRCm39) probably null Het
Tmem147 T G 7: 30,427,716 (GRCm39) probably null Het
Trip12 A T 1: 84,755,170 (GRCm39) D401E probably damaging Het
Ulbp1 A G 10: 7,395,685 (GRCm39) S291P unknown Het
Usp19 A G 9: 108,379,112 (GRCm39) D1286G possibly damaging Het
Usp49 T C 17: 47,989,873 (GRCm39) F553L probably damaging Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90,112,391 (GRCm39) missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90,112,367 (GRCm39) missense probably benign 0.02
IGL03156:Zfp352 APN 4 90,112,324 (GRCm39) missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90,112,939 (GRCm39) missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90,111,994 (GRCm39) missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90,112,583 (GRCm39) missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90,112,522 (GRCm39) missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90,113,246 (GRCm39) missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90,112,927 (GRCm39) missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90,112,156 (GRCm39) missense probably benign
R1034:Zfp352 UTSW 4 90,112,393 (GRCm39) missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90,112,046 (GRCm39) missense probably benign 0.23
R2016:Zfp352 UTSW 4 90,113,408 (GRCm39) missense probably benign 0.42
R2064:Zfp352 UTSW 4 90,113,357 (GRCm39) missense probably benign 0.08
R2308:Zfp352 UTSW 4 90,113,480 (GRCm39) missense probably benign 0.00
R3552:Zfp352 UTSW 4 90,113,339 (GRCm39) missense probably benign 0.33
R3794:Zfp352 UTSW 4 90,113,386 (GRCm39) missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90,113,386 (GRCm39) missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90,113,261 (GRCm39) missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90,112,071 (GRCm39) missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90,113,401 (GRCm39) missense probably benign 0.00
R4590:Zfp352 UTSW 4 90,112,772 (GRCm39) missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90,113,318 (GRCm39) missense probably benign 0.00
R4617:Zfp352 UTSW 4 90,113,318 (GRCm39) missense probably benign 0.00
R4618:Zfp352 UTSW 4 90,113,318 (GRCm39) missense probably benign 0.00
R4741:Zfp352 UTSW 4 90,113,177 (GRCm39) missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90,112,541 (GRCm39) missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90,112,376 (GRCm39) missense probably benign 0.01
R4973:Zfp352 UTSW 4 90,112,376 (GRCm39) missense probably benign 0.01
R5167:Zfp352 UTSW 4 90,112,453 (GRCm39) missense possibly damaging 0.94
R5260:Zfp352 UTSW 4 90,112,697 (GRCm39) missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90,113,341 (GRCm39) missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90,113,307 (GRCm39) missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90,113,437 (GRCm39) missense probably benign 0.33
R6819:Zfp352 UTSW 4 90,112,936 (GRCm39) missense probably benign
R7072:Zfp352 UTSW 4 90,112,661 (GRCm39) missense probably benign 0.00
R7099:Zfp352 UTSW 4 90,113,117 (GRCm39) missense probably benign 0.00
R7569:Zfp352 UTSW 4 90,111,896 (GRCm39) missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90,113,014 (GRCm39) missense probably benign 0.13
R8424:Zfp352 UTSW 4 90,112,480 (GRCm39) missense possibly damaging 0.87
R9180:Zfp352 UTSW 4 90,113,118 (GRCm39) missense probably benign 0.38
R9378:Zfp352 UTSW 4 90,112,575 (GRCm39) missense probably benign 0.13
R9509:Zfp352 UTSW 4 90,112,943 (GRCm39) missense probably damaging 0.99
R9623:Zfp352 UTSW 4 90,113,128 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATACGGGTGTGATGAGCCTG -3'
(R):5'- AGTCACAAGTCTGACCCCAG -3'

Sequencing Primer
(F):5'- ATGAGCCTGGGTGCACATG -3'
(R):5'- AGCTCTGCACATTCTGGACAG -3'
Posted On 2019-11-12