Incidental Mutation 'R0032:Olfr800'
ID59425
Institutional Source Beutler Lab
Gene Symbol Olfr800
Ensembl Gene ENSMUSG00000108114
Gene Nameolfactory receptor 800
SynonymsGA_x6K02T2PULF-11338429-11339364, MOR114-7
MMRRC Submission 038326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0032 (G1) of strain 731
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129657694-129662074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129660400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 198 (V198D)
Ref Sequence ENSEMBL: ENSMUSP00000151047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104903] [ENSMUST00000217094]
Predicted Effect probably benign
Transcript: ENSMUST00000104903
AA Change: V198D

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000100499
Gene: ENSMUSG00000108114
AA Change: V198D

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 7.3e-43 PFAM
Pfam:7tm_1 38 287 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217094
AA Change: V198D

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Ccbe1 T G 18: 66,291,652 T35P possibly damaging Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdk5rap3 A T 11: 96,908,753 L412Q possibly damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dennd4c T C 4: 86,828,150 probably null Het
Des A G 1: 75,362,166 E195G possibly damaging Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcsk5 T C 19: 17,564,815 N804S possibly damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tjp2 A G 19: 24,108,695 L821S probably damaging Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Olfr800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr800 APN 10 129660126 missense probably benign 0.26
IGL01915:Olfr800 APN 10 129660650 missense probably benign 0.05
IGL02458:Olfr800 APN 10 129660606 missense probably benign 0.38
IGL02721:Olfr800 APN 10 129659955 missense probably benign
R0442:Olfr800 UTSW 10 129659824 missense probably benign 0.00
R1564:Olfr800 UTSW 10 129660015 missense probably benign 0.22
R1580:Olfr800 UTSW 10 129660315 missense probably benign 0.10
R1593:Olfr800 UTSW 10 129660225 nonsense probably null
R1911:Olfr800 UTSW 10 129660112 missense probably benign 0.07
R2001:Olfr800 UTSW 10 129660421 missense probably benign 0.02
R2223:Olfr800 UTSW 10 129659809 start codon destroyed probably null 1.00
R3876:Olfr800 UTSW 10 129660274 missense probably benign 0.39
R3884:Olfr800 UTSW 10 129660538 missense probably damaging 1.00
R4366:Olfr800 UTSW 10 129660531 missense probably benign 0.02
R4689:Olfr800 UTSW 10 129660316 missense probably benign 0.01
R4909:Olfr800 UTSW 10 129660720 missense probably benign 0.01
R5638:Olfr800 UTSW 10 129660100 missense possibly damaging 0.80
R5835:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R5838:Olfr800 UTSW 10 129660038 missense probably benign 0.41
R6150:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R6248:Olfr800 UTSW 10 129660663 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CCGATATGTAGCCATCTGCAAACCC -3'
(R):5'- GCTGCCATAGGTGATGGAAACCAC -3'

Sequencing Primer
(F):5'- GCAGGATCTGTACAAGACTTATCCTC -3'
(R):5'- TGGAAACCACAATCATGTGGG -3'
Posted On2013-07-11