Incidental Mutation 'R7705:Ctsf'
ID594258
Institutional Source Beutler Lab
Gene Symbol Ctsf
Ensembl Gene ENSMUSG00000083282
Gene Namecathepsin F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7705 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4855129-4860912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4856539 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 165 (F165V)
Ref Sequence ENSEMBL: ENSMUSP00000112481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]
Predicted Effect probably benign
Transcript: ENSMUST00000006626
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119694
AA Change: F165V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: F165V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Inhibitor_I29 165 222 5.41e-16 SMART
Pept_C1 249 460 4.2e-93 SMART
Meta Mutation Damage Score 0.8977 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,182,252 F359V probably damaging Het
Abcb9 G T 5: 124,081,955 Y342* probably null Het
Acad9 C T 3: 36,088,526 T470M probably benign Het
Ankmy2 A G 12: 36,195,108 E379G probably benign Het
Cand1 A G 10: 119,212,438 probably null Het
Ccdc171 A G 4: 83,557,956 T203A possibly damaging Het
Cpeb4 A G 11: 31,872,327 T14A probably damaging Het
Crtap A T 9: 114,381,679 C276S probably damaging Het
Csf2rb2 T C 15: 78,284,574 I794V probably benign Het
Cux2 T A 5: 121,869,673 M642L probably benign Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Dytn A G 1: 63,678,789 L29P probably damaging Het
E2f3 G A 13: 29,985,323 R116C probably benign Het
Edc3 T C 9: 57,739,914 V282A probably benign Het
Epha1 A G 6: 42,362,668 V630A probably damaging Het
Erc1 A G 6: 119,824,603 I151T probably benign Het
Fam83h C T 15: 76,003,850 R546H probably damaging Het
Fbxl14 A T 6: 119,480,781 K308* probably null Het
Fbxw24 A T 9: 109,608,448 probably null Het
Gldn T A 9: 54,338,692 M509K probably benign Het
Gm14085 A C 2: 122,521,629 probably null Het
Gm4969 T A 7: 19,101,119 D393V unknown Het
Gm8298 G A 3: 59,876,747 A214T probably benign Het
Gpr139 T C 7: 119,144,643 I240V probably benign Het
Herc1 G T 9: 66,439,834 M1990I possibly damaging Het
Hmgcr A G 13: 96,656,723 I467T probably benign Het
Isl2 T C 9: 55,542,401 F85L probably benign Het
Lat T C 7: 126,364,440 N197D probably damaging Het
March1 T C 8: 66,468,517 V282A probably benign Het
Mrpl9 A G 3: 94,443,768 H85R possibly damaging Het
Mterf2 G T 10: 85,120,517 A81E probably damaging Het
Mtr A G 13: 12,249,896 C107R probably benign Het
Nlrp4c T A 7: 6,072,636 V642E probably damaging Het
Olfr1445 A G 19: 12,884,507 I209V probably benign Het
Olfr805 T A 10: 129,723,149 I132F probably benign Het
Pdik1l A G 4: 134,279,493 S112P unknown Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Rest T A 5: 77,268,272 L111Q probably damaging Het
Spg7 A C 8: 123,073,878 D169A possibly damaging Het
Syt3 T C 7: 44,392,659 V314A possibly damaging Het
Tbc1d20 G C 2: 152,308,084 G144R probably damaging Het
Tlk1 A T 2: 70,786,672 probably null Het
Tmem147 T G 7: 30,728,291 probably null Het
Trip12 A T 1: 84,777,449 D401E probably damaging Het
Ulbp1 A G 10: 7,445,685 S291P unknown Het
Usp19 A G 9: 108,501,913 D1286G possibly damaging Het
Usp49 T C 17: 47,678,948 F553L probably damaging Het
Zfp352 A G 4: 90,225,275 T551A possibly damaging Het
Other mutations in Ctsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ctsf APN 19 4858078 missense probably damaging 1.00
IGL01891:Ctsf APN 19 4856567 missense probably damaging 0.99
IGL03291:Ctsf APN 19 4859634 missense probably benign 0.00
R0587:Ctsf UTSW 19 4855738 missense probably benign 0.35
R0831:Ctsf UTSW 19 4859840 missense possibly damaging 0.92
R1808:Ctsf UTSW 19 4856534 missense probably benign 0.00
R5652:Ctsf UTSW 19 4858477 missense probably damaging 1.00
R5662:Ctsf UTSW 19 4856578 missense probably damaging 0.98
R6993:Ctsf UTSW 19 4858483 missense probably benign 0.45
R7702:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7703:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7704:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7962:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7965:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7966:Ctsf UTSW 19 4856539 missense probably damaging 1.00
RF012:Ctsf UTSW 19 4858666 missense probably benign 0.05
Z1176:Ctsf UTSW 19 4856306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAGACAAAGGCCCCTTAATC -3'
(R):5'- CTCCTTGAGAGACACAGGATC -3'

Sequencing Primer
(F):5'- AGACAAAGGCCCCTTAATCCTCTTTC -3'
(R):5'- GACACAATCCAGGCATTTTGGTC -3'
Posted On2019-11-12