Mutagenetix > Incidental Mutation

Incidental Mutation 'R7705:Ctsf'

594258

Institutional Source

Beutler Lab

Gene Symbol

Ctsf

Ensembl Gene

ENSMUSG00000083282

Gene Name

cathepsin F

Synonyms

MMRRC Submission

045766-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R7705 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4905158-4910946 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 4906567 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 165 (F165V)

Ref Sequence

ENSEMBL: ENSMUSP00000112481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]

AlphaFold

Q9R013

Predicted Effect

probably benign
Transcript: ENSMUST00000006626

SMART Domains

Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

Domain	Start	End	E-Value	Type
low complexity region	8	30	N/A	INTRINSIC
CH	46	146	1.4e-23	SMART
CH	159	258	4.83e-27	SMART
low complexity region	261	272	N/A	INTRINSIC
Pfam:Spectrin	287	397	5.5e-15	PFAM
SPEC	410	511	3.78e-23	SMART
SPEC	525	632	2.37e-6	SMART
Pfam:Spectrin	643	746	4.1e-15	PFAM
EFh	763	791	7.93e-1	SMART
EFh	799	827	5.96e-1	SMART
efhand_Ca_insen	830	896	2.29e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119694
AA Change: F165V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: F165V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	111	122	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
Inhibitor_I29	165	222	5.41e-16	SMART
Pept_C1	249	460	4.2e-93	SMART

Meta Mutation Damage Score

0.8977

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2fm3	G	A	3: 59,784,168 (GRCm39)	A214T	probably benign	Het
Abcb9	G	T	5: 124,220,018 (GRCm39)	Y342*	probably null	Het
Acad9	C	T	3: 36,142,675 (GRCm39)	T470M	probably benign	Het
Ankmy2	A	G	12: 36,245,107 (GRCm39)	E379G	probably benign	Het
Cand1	A	G	10: 119,048,343 (GRCm39)		probably null	Het
Ccdc171	A	G	4: 83,476,193 (GRCm39)	T203A	possibly damaging	Het
Cpeb4	A	G	11: 31,822,327 (GRCm39)	T14A	probably damaging	Het
Cplane1	T	G	15: 8,211,736 (GRCm39)	F359V	probably damaging	Het
Crtap	A	T	9: 114,210,747 (GRCm39)	C276S	probably damaging	Het
Csf2rb2	T	C	15: 78,168,774 (GRCm39)	I794V	probably benign	Het
Cux2	T	A	5: 122,007,736 (GRCm39)	M642L	probably benign	Het
Dpep1	T	C	8: 123,927,460 (GRCm39)	V338A	possibly damaging	Het
Dytn	A	G	1: 63,717,948 (GRCm39)	L29P	probably damaging	Het
E2f3	G	A	13: 30,169,306 (GRCm39)	R116C	probably benign	Het
Edc3	T	C	9: 57,647,197 (GRCm39)	V282A	probably benign	Het
Epha1	A	G	6: 42,339,602 (GRCm39)	V630A	probably damaging	Het
Erc1	A	G	6: 119,801,564 (GRCm39)	I151T	probably benign	Het
Fam83h	C	T	15: 75,875,699 (GRCm39)	R546H	probably damaging	Het
Fbxl14	A	T	6: 119,457,742 (GRCm39)	K308*	probably null	Het
Fbxw24	A	T	9: 109,437,516 (GRCm39)		probably null	Het
Gldn	T	A	9: 54,245,976 (GRCm39)	M509K	probably benign	Het
Gpr139	T	C	7: 118,743,866 (GRCm39)	I240V	probably benign	Het
Herc1	G	T	9: 66,347,116 (GRCm39)	M1990I	possibly damaging	Het
Hmgcr	A	G	13: 96,793,231 (GRCm39)	I467T	probably benign	Het
Isl2	T	C	9: 55,449,685 (GRCm39)	F85L	probably benign	Het
Lat	T	C	7: 125,963,612 (GRCm39)	N197D	probably damaging	Het
Marchf1	T	C	8: 66,921,169 (GRCm39)	V282A	probably benign	Het
Meiosin	T	A	7: 18,835,044 (GRCm39)	D393V	unknown	Het
Mrpl9	A	G	3: 94,351,075 (GRCm39)	H85R	possibly damaging	Het
Mterf2	G	T	10: 84,956,381 (GRCm39)	A81E	probably damaging	Het
Mtr	A	G	13: 12,264,782 (GRCm39)	C107R	probably benign	Het
Nlrp4c	T	A	7: 6,075,635 (GRCm39)	V642E	probably damaging	Het
Or5b12b	A	G	19: 12,861,871 (GRCm39)	I209V	probably benign	Het
Or6c212	T	A	10: 129,559,018 (GRCm39)	I132F	probably benign	Het
Pdik1l	A	G	4: 134,006,804 (GRCm39)	S112P	unknown	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 171,956,150 (GRCm39)		probably null	Het
Rest	T	A	5: 77,416,119 (GRCm39)	L111Q	probably damaging	Het
Slc28a2b	A	C	2: 122,352,110 (GRCm39)		probably null	Het
Spg7	A	C	8: 123,800,617 (GRCm39)	D169A	possibly damaging	Het
Syt3	T	C	7: 44,042,083 (GRCm39)	V314A	possibly damaging	Het
Tbc1d20	G	C	2: 152,150,004 (GRCm39)	G144R	probably damaging	Het
Tlk1	A	T	2: 70,617,016 (GRCm39)		probably null	Het
Tmem147	T	G	7: 30,427,716 (GRCm39)		probably null	Het
Trip12	A	T	1: 84,755,170 (GRCm39)	D401E	probably damaging	Het
Ulbp1	A	G	10: 7,395,685 (GRCm39)	S291P	unknown	Het
Usp19	A	G	9: 108,379,112 (GRCm39)	D1286G	possibly damaging	Het
Usp49	T	C	17: 47,989,873 (GRCm39)	F553L	probably damaging	Het
Zfp352	A	G	4: 90,113,512 (GRCm39)	T551A	possibly damaging	Het

Other mutations in Ctsf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01631:Ctsf	APN	19	4,908,106 (GRCm39)	missense	probably damaging	1.00
IGL01891:Ctsf	APN	19	4,906,595 (GRCm39)	missense	probably damaging	0.99
IGL03291:Ctsf	APN	19	4,909,662 (GRCm39)	missense	probably benign	0.00
R0587:Ctsf	UTSW	19	4,905,766 (GRCm39)	missense	probably benign	0.35
R0831:Ctsf	UTSW	19	4,909,868 (GRCm39)	missense	possibly damaging	0.92
R1808:Ctsf	UTSW	19	4,906,562 (GRCm39)	missense	probably benign	0.00
R5652:Ctsf	UTSW	19	4,908,505 (GRCm39)	missense	probably damaging	1.00
R5662:Ctsf	UTSW	19	4,906,606 (GRCm39)	missense	probably damaging	0.98
R6993:Ctsf	UTSW	19	4,908,511 (GRCm39)	missense	probably benign	0.45
R7702:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7703:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7704:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7962:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7965:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7966:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
RF012:Ctsf	UTSW	19	4,908,694 (GRCm39)	missense	probably benign	0.05
Z1176:Ctsf	UTSW	19	4,906,334 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGAGACAAAGGCCCCTTAATC -3'
(R):5'- CTCCTTGAGAGACACAGGATC -3'

Sequencing Primer
(F):5'- AGACAAAGGCCCCTTAATCCTCTTTC -3'
(R):5'- GACACAATCCAGGCATTTTGGTC -3'

Posted On

2019-11-12