Incidental Mutation 'R7705:Olfr1445'
ID594259
Institutional Source Beutler Lab
Gene Symbol Olfr1445
Ensembl Gene ENSMUSG00000045126
Gene Nameolfactory receptor 1445
SynonymsGA_x6K02T2RE5P-3213352-3214296, MOR202-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7705 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12883855-12884855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12884507 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 209 (I209V)
Ref Sequence ENSEMBL: ENSMUSP00000058933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049624] [ENSMUST00000216805]
Predicted Effect probably benign
Transcript: ENSMUST00000049624
AA Change: I209V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000058933
Gene: ENSMUSG00000045126
AA Change: I209V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-54 PFAM
Pfam:7tm_1 39 288 4.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216805
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,182,252 F359V probably damaging Het
Abcb9 G T 5: 124,081,955 Y342* probably null Het
Acad9 C T 3: 36,088,526 T470M probably benign Het
Ankmy2 A G 12: 36,195,108 E379G probably benign Het
Cand1 A G 10: 119,212,438 probably null Het
Ccdc171 A G 4: 83,557,956 T203A possibly damaging Het
Cpeb4 A G 11: 31,872,327 T14A probably damaging Het
Crtap A T 9: 114,381,679 C276S probably damaging Het
Csf2rb2 T C 15: 78,284,574 I794V probably benign Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cux2 T A 5: 121,869,673 M642L probably benign Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Dytn A G 1: 63,678,789 L29P probably damaging Het
E2f3 G A 13: 29,985,323 R116C probably benign Het
Edc3 T C 9: 57,739,914 V282A probably benign Het
Epha1 A G 6: 42,362,668 V630A probably damaging Het
Erc1 A G 6: 119,824,603 I151T probably benign Het
Fam83h C T 15: 76,003,850 R546H probably damaging Het
Fbxl14 A T 6: 119,480,781 K308* probably null Het
Fbxw24 A T 9: 109,608,448 probably null Het
Gldn T A 9: 54,338,692 M509K probably benign Het
Gm14085 A C 2: 122,521,629 probably null Het
Gm4969 T A 7: 19,101,119 D393V unknown Het
Gm8298 G A 3: 59,876,747 A214T probably benign Het
Gpr139 T C 7: 119,144,643 I240V probably benign Het
Herc1 G T 9: 66,439,834 M1990I possibly damaging Het
Hmgcr A G 13: 96,656,723 I467T probably benign Het
Isl2 T C 9: 55,542,401 F85L probably benign Het
Lat T C 7: 126,364,440 N197D probably damaging Het
March1 T C 8: 66,468,517 V282A probably benign Het
Mrpl9 A G 3: 94,443,768 H85R possibly damaging Het
Mterf2 G T 10: 85,120,517 A81E probably damaging Het
Mtr A G 13: 12,249,896 C107R probably benign Het
Nlrp4c T A 7: 6,072,636 V642E probably damaging Het
Olfr805 T A 10: 129,723,149 I132F probably benign Het
Pdik1l A G 4: 134,279,493 S112P unknown Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Rest T A 5: 77,268,272 L111Q probably damaging Het
Spg7 A C 8: 123,073,878 D169A possibly damaging Het
Syt3 T C 7: 44,392,659 V314A possibly damaging Het
Tbc1d20 G C 2: 152,308,084 G144R probably damaging Het
Tlk1 A T 2: 70,786,672 probably null Het
Tmem147 T G 7: 30,728,291 probably null Het
Trip12 A T 1: 84,777,449 D401E probably damaging Het
Ulbp1 A G 10: 7,445,685 S291P unknown Het
Usp19 A G 9: 108,501,913 D1286G possibly damaging Het
Usp49 T C 17: 47,678,948 F553L probably damaging Het
Zfp352 A G 4: 90,225,275 T551A possibly damaging Het
Other mutations in Olfr1445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr1445 APN 19 12883901 missense probably benign 0.03
IGL01786:Olfr1445 APN 19 12884277 missense probably damaging 0.99
IGL02375:Olfr1445 APN 19 12883941 missense probably benign 0.00
IGL03220:Olfr1445 APN 19 12884451 missense possibly damaging 0.80
IGL03232:Olfr1445 APN 19 12884272 nonsense probably null
R0505:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0505:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R0541:Olfr1445 UTSW 19 12884094 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R2187:Olfr1445 UTSW 19 12884255 missense probably damaging 1.00
R2231:Olfr1445 UTSW 19 12883949 missense probably benign 0.00
R3706:Olfr1445 UTSW 19 12883896 missense probably damaging 1.00
R4698:Olfr1445 UTSW 19 12884621 missense probably benign 0.08
R5558:Olfr1445 UTSW 19 12884387 missense probably benign 0.01
R6163:Olfr1445 UTSW 19 12884108 missense probably damaging 1.00
R7057:Olfr1445 UTSW 19 12884642 missense probably damaging 0.98
R7063:Olfr1445 UTSW 19 12884085 missense probably damaging 1.00
R8073:Olfr1445 UTSW 19 12884616 missense probably benign 0.00
R8174:Olfr1445 UTSW 19 12883904 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGCTTGTCTGACCATAGG -3'
(R):5'- CCATCTTGTCAGTGCCCATG -3'

Sequencing Primer
(F):5'- ACCATAGGTTCCTATGTCTGTGGC -3'
(R):5'- CCCATGGTGTGACTGGAACTAG -3'
Posted On2019-11-12