Mutagenetix > Incidental Mutation

Incidental Mutation 'R7706:Klhl20'

594262

Institutional Source

Beutler Lab

Gene Symbol

Klhl20

Ensembl Gene

ENSMUSG00000026705

Gene Name

kelch-like 20

Synonyms

D930050H05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.524) question?

Stock #

R7706 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

161088375-161131511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 161109257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 183 (I183V)

Ref Sequence

ENSEMBL: ENSMUSP00000107238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467]

AlphaFold

Q8VCK5

Predicted Effect

probably benign
Transcript: ENSMUST00000111611
AA Change: I183V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: I183V

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117467
AA Change: I183V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: I183V

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	G	A	17: 45,733,657	T46I	unknown	Het
Arhgef1	G	A	7: 24,916,881	D317N	probably damaging	Het
Atxn7l2	T	C	3: 108,207,403	D109G	probably damaging	Het
B4galnt3	C	A	6: 120,218,952	V305L	probably benign	Het
C9	T	A	15: 6,458,921	N85K	probably benign	Het
Cacna1g	T	C	11: 94,415,041	I1941V	probably benign	Het
Capn15	A	G	17: 25,964,151	V518A	probably benign	Het
Chst10	A	T	1: 38,866,025	Y200N	probably damaging	Het
Cir1	A	G	2: 73,312,479	S4P	probably damaging	Het
Cish	G	A	9: 107,300,641	R172Q	probably benign	Het
Cnot10	A	T	9: 114,593,438	N693K	probably damaging	Het
Ddx6	A	G	9: 44,627,642	D249G	probably damaging	Het
Dennd6b	T	C	15: 89,185,244	D528G	probably benign	Het
Dmtf1	T	A	5: 9,124,489	T484S	possibly damaging	Het
Dnaaf5	T	C	5: 139,152,841	V259A	probably damaging	Het
Dzip1l	A	T	9: 99,637,536	S39C	probably damaging	Het
Efcab8	T	A	2: 153,781,775	M60K		Het
Eml2	T	A	7: 19,186,110	V113D	possibly damaging	Het
Fnip1	A	T	11: 54,515,499	I1141F	probably benign	Het
Gm7298	T	A	6: 121,735,611	S127R	probably damaging	Het
Hcn2	G	A	10: 79,734,183	R622Q	possibly damaging	Het
Ift172	C	T	5: 31,266,379	W746*	probably null	Het
Irs1	A	G	1: 82,287,691	Y935H	probably damaging	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lalba	T	C	15: 98,481,593	D103G	probably damaging	Het
Lpin3	T	C	2: 160,905,290	L822P	probably damaging	Het
Lrrc38	G	A	4: 143,350,275	C36Y	probably damaging	Het
Ly6e	T	C	15: 74,958,334	S46P	possibly damaging	Het
Narfl	T	C	17: 25,782,252	*493Q	probably null	Het
Nav2	T	C	7: 49,594,319	I2098T	probably benign	Het
Nipbl	T	C	15: 8,351,526	E594G	probably benign	Het
Olfr552	T	A	7: 102,604,646	H97Q	probably benign	Het
Parn	T	C	16: 13,607,253	D432G	probably damaging	Het
Pcdh20	A	G	14: 88,467,357	S836P	probably damaging	Het
Pcmtd2	C	T	2: 181,855,075	R282C	probably damaging	Het
Ppp2r3c	A	G	12: 55,281,705	I425T	probably benign	Het
Samm50	T	A	15: 84,200,880		probably null	Het
Sars	C	T	3: 108,431,464		probably null	Het
Senp8	A	G	9: 59,737,838	Y12H	possibly damaging	Het
Slc13a4	T	C	6: 35,270,355	I577V	possibly damaging	Het
Srr	T	G	11: 74,913,135		probably null	Het
Steap2	T	A	5: 5,682,967	N19I	possibly damaging	Het
Sucla2	A	G	14: 73,568,993	Y168C	probably damaging	Het
Tha1	T	C	11: 117,869,455	Q275R	probably damaging	Het
Trim56	T	C	5: 137,114,656	N2S	probably benign	Het
Tubgcp6	T	A	15: 89,104,223	H849L	probably benign	Het
Uevld	A	G	7: 46,948,027	I72T	possibly damaging	Het
Ybx1	A	G	4: 119,278,967	*323Q	probably null	Het
Zfp354b	C	T	11: 50,928,563		probably null	Het
Zfp36l2	A	T	17: 84,186,918	L97Q	probably benign	Het
Zfp729a	T	A	13: 67,623,493	R78S	possibly damaging	Het

Other mutations in Klhl20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Klhl20	APN	1	161109755	missense	probably benign	0.00
IGL00903:Klhl20	APN	1	161090506	missense	probably benign	0.00
IGL01574:Klhl20	APN	1	161093726	missense	probably damaging	1.00
IGL01721:Klhl20	APN	1	161095587	missense	probably damaging	1.00
IGL01933:Klhl20	APN	1	161106787	missense	probably damaging	1.00
IGL02187:Klhl20	APN	1	161109710	missense	probably benign	0.05
IGL02634:Klhl20	APN	1	161098365	missense	probably damaging	0.98
IGL02691:Klhl20	APN	1	161106874	splice site	probably benign
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0639:Klhl20	UTSW	1	161093711	missense	probably damaging	1.00
R1730:Klhl20	UTSW	1	161102990	missense	possibly damaging	0.82
R1856:Klhl20	UTSW	1	161106742	missense	probably benign	0.00
R2016:Klhl20	UTSW	1	161103038	missense	probably damaging	0.98
R2901:Klhl20	UTSW	1	161109552	nonsense	probably null
R4822:Klhl20	UTSW	1	161093763	nonsense	probably null
R4830:Klhl20	UTSW	1	161098376	missense	probably benign	0.00
R4894:Klhl20	UTSW	1	161109532	missense	possibly damaging	0.76
R4981:Klhl20	UTSW	1	161103005	missense	possibly damaging	0.48
R5018:Klhl20	UTSW	1	161101586	missense	probably damaging	0.98
R5023:Klhl20	UTSW	1	161109220	critical splice donor site	probably null
R5108:Klhl20	UTSW	1	161099250	missense	probably damaging	0.99
R5216:Klhl20	UTSW	1	161093679	critical splice donor site	probably null
R5659:Klhl20	UTSW	1	161090470	missense	probably damaging	1.00
R6159:Klhl20	UTSW	1	161105467	missense	probably damaging	1.00
R6836:Klhl20	UTSW	1	161105406	missense	probably benign	0.18
R6914:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6915:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6920:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R7976:Klhl20	UTSW	1	161106737	missense	probably benign	0.02
R7991:Klhl20	UTSW	1	161106864	missense	possibly damaging	0.89
R8085:Klhl20	UTSW	1	161093784	missense	probably damaging	1.00
R8118:Klhl20	UTSW	1	161098401	splice site	probably null
R8204:Klhl20	UTSW	1	161106844	missense	probably benign	0.04
R8678:Klhl20	UTSW	1	161109427	missense	probably damaging	1.00
R9093:Klhl20	UTSW	1	161095661	nonsense	probably null
R9094:Klhl20	UTSW	1	161105485	missense	probably damaging	1.00
R9360:Klhl20	UTSW	1	161093699	missense	probably benign	0.06
R9532:Klhl20	UTSW	1	161109759	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTAGCAACTGAACTACCTCACTGG -3'
(R):5'- TGTGGAAGAGGGCAATGTTC -3'

Sequencing Primer
(F):5'- CAAACCACTTAGTACAGCTTGTG -3'
(R):5'- AGGGCAATGTTCAGACTCTC -3'

Posted On

2019-11-12