Incidental Mutation 'R7706:Atxn7l2'
ID594267
Institutional Source Beutler Lab
Gene Symbol Atxn7l2
Ensembl Gene ENSMUSG00000048997
Gene Nameataxin 7-like 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108202222-108210934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108207403 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 109 (D109G)
Ref Sequence ENSEMBL: ENSMUSP00000099693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102633] [ENSMUST00000117409] [ENSMUST00000117784] [ENSMUST00000119650] [ENSMUST00000127157] [ENSMUST00000141387]
Predicted Effect probably damaging
Transcript: ENSMUST00000102633
AA Change: D109G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099693
Gene: ENSMUSG00000048997
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 198 265 3.9e-29 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117409
AA Change: D109G

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112976
Gene: ENSMUSG00000048997
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 164 235 1.2e-31 PFAM
low complexity region 301 320 N/A INTRINSIC
low complexity region 324 331 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117784
AA Change: D109G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114031
Gene: ENSMUSG00000048997
AA Change: D109G

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 196 267 1.6e-31 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119650
AA Change: D74G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113020
Gene: ENSMUSG00000048997
AA Change: D74G

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
Pfam:SCA7 161 232 1.2e-31 PFAM
low complexity region 298 317 N/A INTRINSIC
low complexity region 321 328 N/A INTRINSIC
low complexity region 400 417 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127157
AA Change: D109G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119223
Gene: ENSMUSG00000048997
AA Change: D109G

DomainStartEndE-ValueType
Blast:ZnF_C2H2 23 45 1e-5 BLAST
low complexity region 55 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141387
SMART Domains Protein: ENSMUSP00000116756
Gene: ENSMUSG00000027887

DomainStartEndE-ValueType
low complexity region 9 65 N/A INTRINSIC
Pfam:MARVEL 107 309 7.2e-41 PFAM
low complexity region 318 326 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Atxn7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Atxn7l2 APN 3 108203543 missense probably damaging 1.00
IGL02381:Atxn7l2 APN 3 108204495 unclassified probably benign
IGL03179:Atxn7l2 APN 3 108203647 nonsense probably null
R0610:Atxn7l2 UTSW 3 108204774 missense possibly damaging 0.80
R1454:Atxn7l2 UTSW 3 108208432 unclassified probably benign
R2474:Atxn7l2 UTSW 3 108203977 missense probably damaging 0.96
R4319:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4322:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4324:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4797:Atxn7l2 UTSW 3 108204550 missense probably damaging 1.00
R5825:Atxn7l2 UTSW 3 108204811 missense probably damaging 1.00
R5916:Atxn7l2 UTSW 3 108205662 unclassified probably null
Z1176:Atxn7l2 UTSW 3 108205666 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTTGGGTGAACTCCAAG -3'
(R):5'- AAAGAAGACATGGGCCCCTC -3'

Sequencing Primer
(F):5'- GTGAGCAGTATCCTGCAA -3'
(R):5'- TCAGCAAGCTTTATGCCCGG -3'
Posted On2019-11-12