Incidental Mutation 'R7706:Ybx1'
ID594269
Institutional Source Beutler Lab
Gene Symbol Ybx1
Ensembl Gene ENSMUSG00000028639
Gene NameY box protein 1
SynonymsdbpB, DNA binding protein B, EF1A, MSY1, Nsep1, YB-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7706 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location119277981-119294604 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 119278967 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 323 (*323Q)
Ref Sequence ENSEMBL: ENSMUSP00000078589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079644] [ENSMUST00000127737]
Predicted Effect probably null
Transcript: ENSMUST00000079644
AA Change: *323Q
SMART Domains Protein: ENSMUSP00000078589
Gene: ENSMUSG00000028639
AA Change: *323Q

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 25 48 N/A INTRINSIC
CSP 58 126 8.65e-24 SMART
low complexity region 140 159 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
low complexity region 179 206 N/A INTRINSIC
low complexity region 236 254 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127737
AA Change: *215Q
SMART Domains Protein: ENSMUSP00000117225
Gene: ENSMUSG00000028639
AA Change: *215Q

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit embryonic and perinatal lethality and are severely growth retarded. Some mice exhibit craniofacial defects and respiratory failure. MEFs are more sensitive to oxidative stress resulting in premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Ybx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ybx1 APN 4 119282312 missense probably damaging 1.00
IGL02635:Ybx1 APN 4 119279089 missense possibly damaging 0.88
R0136:Ybx1 UTSW 4 119282354 missense possibly damaging 0.57
R0270:Ybx1 UTSW 4 119281591 missense probably benign 0.11
R4911:Ybx1 UTSW 4 119282813 missense probably benign 0.13
R4957:Ybx1 UTSW 4 119278938 utr 3 prime probably benign
R4986:Ybx1 UTSW 4 119282430 missense probably damaging 0.99
R5205:Ybx1 UTSW 4 119279151 missense probably damaging 1.00
R7098:Ybx1 UTSW 4 119282853 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GATTCAGAATGTAGGCAGCTCATAATC -3'
(R):5'- TCGCCAAAGACAGCCTAGAG -3'

Sequencing Primer
(F):5'- TCTTTGCACCGTAGCTCA -3'
(R):5'- CAAAGAAAATCAAGGAGATGAGACCC -3'
Posted On2019-11-12