Incidental Mutation 'R7706:Lrrc38'
ID594270
Institutional Source Beutler Lab
Gene Symbol Lrrc38
Ensembl Gene ENSMUSG00000028584
Gene Nameleucine rich repeat containing 38
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143349757-143371032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143350275 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 36 (C36Y)
Ref Sequence ENSEMBL: ENSMUSP00000053597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052458]
Predicted Effect probably damaging
Transcript: ENSMUST00000052458
AA Change: C36Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053597
Gene: ENSMUSG00000028584
AA Change: C36Y

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
LRRNT 31 64 2.82e-4 SMART
LRR 84 106 1.37e1 SMART
LRR 108 130 5.26e0 SMART
LRR 132 154 2.27e1 SMART
LRR 155 178 8.09e-1 SMART
LRRCT 190 244 8.63e-6 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Lrrc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Lrrc38 UTSW 4 143350409 missense probably damaging 0.99
R0545:Lrrc38 UTSW 4 143350758 missense probably benign 0.41
R1078:Lrrc38 UTSW 4 143350518 missense probably benign 0.06
R1467:Lrrc38 UTSW 4 143369880 missense probably damaging 1.00
R1467:Lrrc38 UTSW 4 143369880 missense probably damaging 1.00
R1967:Lrrc38 UTSW 4 143369983 missense unknown
R2221:Lrrc38 UTSW 4 143369849 nonsense probably null
R2223:Lrrc38 UTSW 4 143369849 nonsense probably null
R4061:Lrrc38 UTSW 4 143350506 missense probably damaging 1.00
R4930:Lrrc38 UTSW 4 143369868 missense probably damaging 0.98
R5585:Lrrc38 UTSW 4 143350391 missense probably damaging 0.96
R6787:Lrrc38 UTSW 4 143369794 missense probably benign 0.18
R7046:Lrrc38 UTSW 4 143350169 start codon destroyed probably null
R8189:Lrrc38 UTSW 4 143350733 missense probably damaging 1.00
R8190:Lrrc38 UTSW 4 143350733 missense probably damaging 1.00
R8192:Lrrc38 UTSW 4 143350733 missense probably damaging 1.00
R8219:Lrrc38 UTSW 4 143350733 missense probably damaging 1.00
R8221:Lrrc38 UTSW 4 143350733 missense probably damaging 1.00
R8223:Lrrc38 UTSW 4 143350733 missense probably damaging 1.00
R8226:Lrrc38 UTSW 4 143350733 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCGGGTAAATTCTGCG -3'
(R):5'- TTGTTCCTGAAATCCAGATACACC -3'

Sequencing Primer
(F):5'- GGGTAAATTCTGCGCCCAG -3'
(R):5'- GATACACCAGATCTCCATGGAAGATG -3'
Posted On2019-11-12