Incidental Mutation 'R7706:Dmtf1'
ID594272
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Namecyclin D binding myb-like transcription factor 1
SynonymsDmp1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location9118801-9161776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9124489 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 484 (T484S)
Ref Sequence ENSEMBL: ENSMUSP00000071815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071921
AA Change: T484S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508
AA Change: T484S

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095017
AA Change: T414S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508
AA Change: T414S

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183448
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000183973
AA Change: T396S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508
AA Change: T396S

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184120
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000184159
AA Change: K407N
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508
AA Change: K407N

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000184401
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184620
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184888
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9136070 missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9120056 missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9121853 missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9130381 missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9136098 missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9140474 missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9124435 intron probably benign
R0149:Dmtf1 UTSW 5 9132571 missense probably damaging 1.00
R0466:Dmtf1 UTSW 5 9132454 critical splice donor site probably null
R0825:Dmtf1 UTSW 5 9130388 missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0974:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9136109 missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9140383 splice site probably null
R1478:Dmtf1 UTSW 5 9121404 missense possibly damaging 0.93
R1515:Dmtf1 UTSW 5 9140384 critical splice donor site probably null
R1861:Dmtf1 UTSW 5 9120347 splice site probably null
R1898:Dmtf1 UTSW 5 9128091 missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9129323 missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9129316 missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9132454 intron probably benign
R4467:Dmtf1 UTSW 5 9136085 missense probably damaging 1.00
R4490:Dmtf1 UTSW 5 9140379 intron probably benign
R4491:Dmtf1 UTSW 5 9140379 intron probably benign
R5007:Dmtf1 UTSW 5 9122439 unclassified probably benign
R5173:Dmtf1 UTSW 5 9140356 intron probably benign
R5184:Dmtf1 UTSW 5 9126641 missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9124515 missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9122415 unclassified probably benign
R5977:Dmtf1 UTSW 5 9140451 missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9126656 missense probably benign
R6887:Dmtf1 UTSW 5 9137149 missense probably damaging 1.00
R6921:Dmtf1 UTSW 5 9130654 intron probably benign
R7242:Dmtf1 UTSW 5 9149016 missense possibly damaging 0.90
R7721:Dmtf1 UTSW 5 9126564 missense probably damaging 1.00
R7739:Dmtf1 UTSW 5 9140453 missense probably damaging 1.00
R7742:Dmtf1 UTSW 5 9122457 unclassified probably benign
R7859:Dmtf1 UTSW 5 9128044 missense probably damaging 1.00
R7883:Dmtf1 UTSW 5 9140397 missense probably benign 0.35
R7942:Dmtf1 UTSW 5 9128044 missense probably damaging 1.00
R7966:Dmtf1 UTSW 5 9140397 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AAGTGGATGTCTCACTTGTCTAGAC -3'
(R):5'- AAGCTGGCAGTGGGCTAATG -3'

Sequencing Primer
(F):5'- AGACTGTCCATCTGGCCTCAG -3'
(R):5'- GTGTCTGATCTTTGCGCCATCG -3'
Posted On2019-11-12