Incidental Mutation 'R7706:Gm7298'
ID594277
Institutional Source Beutler Lab
Gene Symbol Gm7298
Ensembl Gene ENSMUSG00000108022
Gene Namepredicted gene 7298
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location121732932-121789084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121735611 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 127 (S127R)
Ref Sequence ENSEMBL: ENSMUSP00000145242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204124]
Predicted Effect probably damaging
Transcript: ENSMUST00000204124
AA Change: S127R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145242
Gene: ENSMUSG00000108022
AA Change: S127R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 4e-18 PFAM
A2M_N_2 449 599 1e-45 SMART
A2M 740 830 2.1e-39 SMART
Pfam:Thiol-ester_cl 963 992 1.9e-15 PFAM
Pfam:A2M_comp 1012 1268 1.6e-90 PFAM
A2M_recep 1378 1465 4.3e-42 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Gm7298
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Gm7298 UTSW 6 121774050 missense probably benign
R4978:Gm7298 UTSW 6 121733117 critical splice donor site probably null
R4980:Gm7298 UTSW 6 121759239 intron probably null
R6000:Gm7298 UTSW 6 121765079 missense possibly damaging 0.91
R6160:Gm7298 UTSW 6 121764927 missense probably benign 0.28
R6180:Gm7298 UTSW 6 121760823 missense probably benign 0.01
R6243:Gm7298 UTSW 6 121779137 missense possibly damaging 0.88
R6266:Gm7298 UTSW 6 121782704 missense probably damaging 1.00
R6268:Gm7298 UTSW 6 121779073 missense possibly damaging 0.83
R6363:Gm7298 UTSW 6 121788606 missense probably damaging 1.00
R6364:Gm7298 UTSW 6 121779443 missense possibly damaging 0.90
R6527:Gm7298 UTSW 6 121769710 missense probably benign 0.01
R6538:Gm7298 UTSW 6 121776173 missense probably damaging 0.98
R6801:Gm7298 UTSW 6 121775809 missense probably benign 0.03
R6884:Gm7298 UTSW 6 121760521 missense possibly damaging 0.74
R6935:Gm7298 UTSW 6 121767694 missense probably benign 0.02
R7051:Gm7298 UTSW 6 121775034 critical splice donor site probably null
R7144:Gm7298 UTSW 6 121761587 missense probably damaging 0.99
R7178:Gm7298 UTSW 6 121785896 missense probably damaging 0.98
R7398:Gm7298 UTSW 6 121781953 missense probably benign 0.02
R7793:Gm7298 UTSW 6 121760604 critical splice donor site probably null
R7829:Gm7298 UTSW 6 121765338 missense probably damaging 1.00
R7877:Gm7298 UTSW 6 121782782 nonsense probably null
R7960:Gm7298 UTSW 6 121782782 nonsense probably null
R8010:Gm7298 UTSW 6 121735583 missense probably benign
Z1176:Gm7298 UTSW 6 121764870 missense probably benign 0.03
Z1176:Gm7298 UTSW 6 121764875 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTTTCCTGTGAGGTGAAAGGAAAG -3'
(R):5'- ACTCACCAACTCATTCAGGGG -3'

Sequencing Primer
(F):5'- CTGTGAGGTGAAAGGAAAGACTAATG -3'
(R):5'- CAACTCATTCAGGGGGCGTAG -3'
Posted On2019-11-12