Incidental Mutation 'R0032:Cdk5rap3'
ID59428
Institutional Source Beutler Lab
Gene Symbol Cdk5rap3
Ensembl Gene ENSMUSG00000018669
Gene NameCDK5 regulatory subunit associated protein 3
SynonymsHSF-27, IC53, OK/SW-cl.114, 1810007E24Rik, MST016, C53
MMRRC Submission 038326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0032 (G1) of strain 731
Quality Score163
Status Validated
Chromosome11
Chromosomal Location96907426-96916496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96908753 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 412 (L412Q)
Ref Sequence ENSEMBL: ENSMUSP00000099441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103152] [ENSMUST00000127048] [ENSMUST00000130774] [ENSMUST00000134732] [ENSMUST00000144731] [ENSMUST00000147573] [ENSMUST00000153305] [ENSMUST00000156315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103152
AA Change: L412Q

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099441
Gene: ENSMUSG00000018669
AA Change: L412Q

DomainStartEndE-ValueType
Pfam:DUF773 4 500 3.7e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127048
SMART Domains Protein: ENSMUSP00000114849
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 145 1.4e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130767
Predicted Effect probably benign
Transcript: ENSMUST00000130774
SMART Domains Protein: ENSMUSP00000114661
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 80 1.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134732
SMART Domains Protein: ENSMUSP00000120258
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 107 4.7e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144731
SMART Domains Protein: ENSMUSP00000114724
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 124 9.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149033
Predicted Effect probably benign
Transcript: ENSMUST00000153305
SMART Domains Protein: ENSMUSP00000116405
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 115 4.2e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154289
Predicted Effect probably benign
Transcript: ENSMUST00000156315
SMART Domains Protein: ENSMUSP00000123113
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 140 2.2e-79 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been reported to function in signaling pathways governing transcriptional regulation and cell cycle progression. It may play a role in tumorigenesis and metastasis. A pseudogene of this gene is located on the long arm of chromosome 20. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Ccbe1 T G 18: 66,291,652 T35P possibly damaging Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dennd4c T C 4: 86,828,150 probably null Het
Des A G 1: 75,362,166 E195G possibly damaging Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr800 T A 10: 129,660,400 V198D probably benign Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcsk5 T C 19: 17,564,815 N804S possibly damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tjp2 A G 19: 24,108,695 L821S probably damaging Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Cdk5rap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cdk5rap3 APN 11 96913399 missense probably damaging 1.00
IGL00958:Cdk5rap3 APN 11 96909967 missense probably benign 0.04
IGL00964:Cdk5rap3 APN 11 96909939 critical splice donor site probably null
IGL01767:Cdk5rap3 APN 11 96913465 missense probably damaging 1.00
IGL02321:Cdk5rap3 APN 11 96913465 missense probably damaging 1.00
IGL02352:Cdk5rap3 APN 11 96916177 missense probably damaging 1.00
R0894:Cdk5rap3 UTSW 11 96908828 missense probably damaging 1.00
R1795:Cdk5rap3 UTSW 11 96908828 missense probably damaging 1.00
R5035:Cdk5rap3 UTSW 11 96916085 utr 5 prime probably benign
R5530:Cdk5rap3 UTSW 11 96911633 nonsense probably null
R5782:Cdk5rap3 UTSW 11 96911586 missense probably benign 0.01
R6278:Cdk5rap3 UTSW 11 96911903 missense probably damaging 1.00
R6888:Cdk5rap3 UTSW 11 96916192 missense probably benign 0.33
R7526:Cdk5rap3 UTSW 11 96909945 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCTGTCTGCACTTAACTGCTG -3'
(R):5'- TGGTCTGAACGAAGTCCCTTTCCC -3'

Sequencing Primer
(F):5'- CAACTTAGGAACCAGGTTCTGTC -3'
(R):5'- GAAGTCCCTTTCCCTCCTCAG -3'
Posted On2013-07-11