Incidental Mutation 'R7706:Olfr552'
ID594281
Institutional Source Beutler Lab
Gene Symbol Olfr552
Ensembl Gene ENSMUSG00000073973
Gene Nameolfactory receptor 552
SynonymsGA_x6K02T2PBJ9-5323062-5324015, MOR28-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102597770-102608125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102604646 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 97 (H97Q)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
Predicted Effect probably benign
Transcript: ENSMUST00000098223
AA Change: H97Q

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: H97Q

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215712
AA Change: H97Q

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Olfr552
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr552 APN 7 102604357 start codon destroyed probably null 0.99
IGL03061:Olfr552 APN 7 102604739 missense probably damaging 0.99
R0989:Olfr552 UTSW 7 102604483 missense probably damaging 1.00
R1513:Olfr552 UTSW 7 102605302 missense probably benign 0.09
R1969:Olfr552 UTSW 7 102604570 missense probably damaging 0.99
R3177:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R3277:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R4019:Olfr552 UTSW 7 102604642 missense probably damaging 1.00
R4028:Olfr552 UTSW 7 102605293 missense possibly damaging 0.62
R5216:Olfr552 UTSW 7 102604821 missense probably benign 0.00
R5444:Olfr552 UTSW 7 102604869 nonsense probably null
R5461:Olfr552 UTSW 7 102604408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACCTTGGCTGTGCTTGGC -3'
(R):5'- CTCGACAGTAATGGAAACGTCTG -3'

Sequencing Primer
(F):5'- TGCTTGGCAACTGCACC -3'
(R):5'- TGGAGTCATTAGTGTCACAGCCC -3'
Posted On2019-11-12