Incidental Mutation 'R7706:Dzip1l'
ID594284
Institutional Source Beutler Lab
Gene Symbol Dzip1l
Ensembl Gene ENSMUSG00000037784
Gene NameDAZ interacting protein 1-like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99629496-99669256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99637536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 39 (S39C)
Ref Sequence ENSEMBL: ENSMUSP00000077475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078367] [ENSMUST00000112884] [ENSMUST00000112885] [ENSMUST00000112886] [ENSMUST00000131095]
Predicted Effect probably damaging
Transcript: ENSMUST00000078367
AA Change: S39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077475
Gene: ENSMUSG00000037784
AA Change: S39C

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 5e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112884
AA Change: S39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108505
Gene: ENSMUSG00000037784
AA Change: S39C

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112885
AA Change: S39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108506
Gene: ENSMUSG00000037784
AA Change: S39C

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112886
AA Change: S39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108507
Gene: ENSMUSG00000037784
AA Change: S39C

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131095
AA Change: S39C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116647
Gene: ENSMUSG00000037784
AA Change: S39C

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 125 6.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Dzip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dzip1l APN 9 99637777 missense probably damaging 0.99
IGL01992:Dzip1l APN 9 99663686 missense probably damaging 1.00
R0276:Dzip1l UTSW 9 99660998 missense probably benign 0.38
R0506:Dzip1l UTSW 9 99663081 missense possibly damaging 0.76
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R2904:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2905:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2911:Dzip1l UTSW 9 99655602 missense probably benign 0.00
R3106:Dzip1l UTSW 9 99642572 nonsense probably null
R3106:Dzip1l UTSW 9 99647121 missense probably benign 0.00
R4394:Dzip1l UTSW 9 99639854 missense probably damaging 1.00
R4570:Dzip1l UTSW 9 99647168 nonsense probably null
R4579:Dzip1l UTSW 9 99647214 missense probably damaging 1.00
R4695:Dzip1l UTSW 9 99647205 missense probably benign 0.11
R4696:Dzip1l UTSW 9 99663611 missense possibly damaging 0.94
R4748:Dzip1l UTSW 9 99642651 missense probably damaging 0.96
R5063:Dzip1l UTSW 9 99667652 missense probably damaging 1.00
R5747:Dzip1l UTSW 9 99639809 splice site probably null
R6089:Dzip1l UTSW 9 99642684 missense possibly damaging 0.63
R7030:Dzip1l UTSW 9 99665835 missense probably benign 0.00
R7454:Dzip1l UTSW 9 99659674 missense possibly damaging 0.59
R7485:Dzip1l UTSW 9 99661012 missense probably benign 0.02
R7734:Dzip1l UTSW 9 99667682 missense probably damaging 1.00
R7790:Dzip1l UTSW 9 99660962 missense possibly damaging 0.58
Z1176:Dzip1l UTSW 9 99641761 missense possibly damaging 0.59
Z1177:Dzip1l UTSW 9 99665854 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCATGTAACTTGGACCCTTC -3'
(R):5'- TGCAGCAGGTACTCAATGATG -3'

Sequencing Primer
(F):5'- AACTTGGACCCTTCTATTTTCCAGG -3'
(R):5'- CTCAATGATGAGCTGTGCCAG -3'
Posted On2019-11-12