Incidental Mutation 'R7706:Hcn2'
ID594287
Institutional Source Beutler Lab
Gene Symbol Hcn2
Ensembl Gene ENSMUSG00000020331
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 2
SynonymsHAC1, trls
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79716634-79736108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79734183 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 622 (R622Q)
Ref Sequence ENSEMBL: ENSMUSP00000097113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020580] [ENSMUST00000020581] [ENSMUST00000099513] [ENSMUST00000159016] [ENSMUST00000162694]
Predicted Effect probably benign
Transcript: ENSMUST00000020580
SMART Domains Protein: ENSMUSP00000020580
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 802 1207 5.6e-169 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000020581
AA Change: R622Q

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331
AA Change: R622Q

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099513
AA Change: R622Q

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331
AA Change: R622Q

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159016
SMART Domains Protein: ENSMUSP00000124936
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 601 6.27e-50 SMART
low complexity region 629 640 N/A INTRINSIC
Pfam:RNA_pol 727 1133 7.5e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161662
SMART Domains Protein: ENSMUSP00000124230
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
Pfam:RNA_pol 29 120 6.7e-39 PFAM
Pfam:RNA_pol 119 393 2.7e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162694
SMART Domains Protein: ENSMUSP00000124556
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 801 895 6.4e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a hyperpolarization-activated cation channel involved in the generation of native pacemaker activity in the heart and in the brain. The encoded protein is activated by cAMP and can produce a fast, large current. Defects in this gene were noted as a possible cause of some forms of epilepsy. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for mutant alleles exhibit decreased body weight, behavioral/neurological abnormalities, and tremors or absence seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Hcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Hcn2 APN 10 79733803 nonsense probably null
IGL01339:Hcn2 APN 10 79729068 missense probably damaging 1.00
IGL02183:Hcn2 APN 10 79724813 critical splice donor site probably null
asombrarse UTSW 10 79724611 missense probably damaging 1.00
curveball UTSW 10 79724786 missense probably damaging 1.00
curveball2 UTSW 10 79733773 nonsense probably null
mire UTSW 10 79729113 critical splice donor site probably null
R0269:Hcn2 UTSW 10 79734241 unclassified probably benign
R0671:Hcn2 UTSW 10 79734232 splice site probably null
R1879:Hcn2 UTSW 10 79726189 missense probably benign 0.03
R1913:Hcn2 UTSW 10 79730943 missense probably benign 0.14
R4051:Hcn2 UTSW 10 79733687 unclassified probably null
R4052:Hcn2 UTSW 10 79733687 unclassified probably null
R4328:Hcn2 UTSW 10 79724611 missense probably damaging 1.00
R4507:Hcn2 UTSW 10 79724786 missense probably damaging 1.00
R4518:Hcn2 UTSW 10 79724702 missense probably benign 0.17
R4578:Hcn2 UTSW 10 79724448 synonymous probably null
R5334:Hcn2 UTSW 10 79726291 missense probably damaging 0.99
R5788:Hcn2 UTSW 10 79717111 missense possibly damaging 0.48
R6131:Hcn2 UTSW 10 79733908 missense probably damaging 1.00
R6457:Hcn2 UTSW 10 79733773 nonsense probably null
R6547:Hcn2 UTSW 10 79717152 missense probably benign 0.29
R6851:Hcn2 UTSW 10 79729113 critical splice donor site probably null
R7276:Hcn2 UTSW 10 79729100 missense possibly damaging 0.95
R7893:Hcn2 UTSW 10 79724411 missense probably damaging 1.00
R7976:Hcn2 UTSW 10 79724411 missense probably damaging 1.00
X0024:Hcn2 UTSW 10 79734120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGCAGTGGCATAGTTTG -3'
(R):5'- TATTGAGCCTGAGCCGTTC -3'

Sequencing Primer
(F):5'- CATAGTTTGGCTGCTGAGGC -3'
(R):5'- ACCAGGCCCTGTGATTCTG -3'
Posted On2019-11-12