Incidental Mutation 'R7706:Fnip1'
ID594289
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R7706 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54515499 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1141 (I1141F)
Ref Sequence ENSEMBL: ENSMUSP00000049026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835]
Predicted Effect probably benign
Transcript: ENSMUST00000046835
AA Change: I1141F

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: I1141F

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7866:Fnip1 UTSW 11 54465402 start gained probably benign
R7949:Fnip1 UTSW 11 54465402 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATCCATTCCTTTGAGTCTGTGG -3'
(R):5'- ATGCGTTCACCTAAAGCGTAATG -3'

Sequencing Primer
(F):5'- CATTCCTTTGAGTCTGTGGTGCTAC -3'
(R):5'- GCGTAATGCACAAAACAAACATC -3'
Posted On2019-11-12