Incidental Mutation 'R7706:Srr'
ID594290
Institutional Source Beutler Lab
Gene Symbol Srr
Ensembl Gene ENSMUSG00000001323
Gene Nameserine racemase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74906359-74925948 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 74913135 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045807] [ENSMUST00000065211] [ENSMUST00000065211] [ENSMUST00000065211] [ENSMUST00000108447] [ENSMUST00000108448] [ENSMUST00000121738] [ENSMUST00000123855] [ENSMUST00000128230] [ENSMUST00000128556] [ENSMUST00000138612] [ENSMUST00000153316]
Predicted Effect probably benign
Transcript: ENSMUST00000045807
SMART Domains Protein: ENSMUSP00000039027
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
AARP2CN 228 309 1.14e-28 SMART
low complexity region 373 383 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
low complexity region 429 452 N/A INTRINSIC
coiled coil region 453 478 N/A INTRINSIC
DUF663 486 772 2.6e-179 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065211
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065211
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065211
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108447
SMART Domains Protein: ENSMUSP00000104086
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 179 1.8e-41 PFAM
Pfam:PALP 173 289 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108448
SMART Domains Protein: ENSMUSP00000104087
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 2.1e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121738
SMART Domains Protein: ENSMUSP00000113372
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123855
SMART Domains Protein: ENSMUSP00000118485
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 166 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128230
SMART Domains Protein: ENSMUSP00000121384
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128556
SMART Domains Protein: ENSMUSP00000120012
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 182 2.6e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138612
SMART Domains Protein: ENSMUSP00000119256
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 112 4.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153316
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased D-serine levels in the cerebral cortex and hippocampus, and neuronal damage associated with NMDA excitotoxicity and beta-amyloid peptide 1-42 exposure is decreased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Srr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02949:Srr APN 11 74908737 missense probably benign 0.00
IGL03268:Srr APN 11 74913117 missense probably benign 0.06
PIT4382001:Srr UTSW 11 74910308 missense probably benign 0.42
R0718:Srr UTSW 11 74911065 missense possibly damaging 0.74
R1588:Srr UTSW 11 74908803 missense possibly damaging 0.93
R1960:Srr UTSW 11 74908716 missense probably damaging 1.00
R1986:Srr UTSW 11 74908719 missense probably damaging 1.00
R4043:Srr UTSW 11 74909121 missense probably benign 0.08
R4112:Srr UTSW 11 74913072 missense probably benign
R4877:Srr UTSW 11 74907780 unclassified probably benign
R5856:Srr UTSW 11 74913012 missense possibly damaging 0.92
R5959:Srr UTSW 11 74911065 missense possibly damaging 0.74
R6362:Srr UTSW 11 74910202 missense probably damaging 1.00
R7163:Srr UTSW 11 74913002 missense probably damaging 0.96
R7817:Srr UTSW 11 74908698 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGCAACCTCTTGTTTCCAG -3'
(R):5'- TGTACCAGTGCCAAGAGGTG -3'

Sequencing Primer
(F):5'- ACCTCTTGTTTCCAGCTGCAAAAAG -3'
(R):5'- CAGTGCCAAGAGGTGTGTGTG -3'
Posted On2019-11-12