Incidental Mutation 'R7706:Tha1'
ID594292
Institutional Source Beutler Lab
Gene Symbol Tha1
Ensembl Gene ENSMUSG00000017713
Gene Namethreonine aldolase 1
SynonymsGLY1, 1300017K07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location117867952-117873481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117869455 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 275 (Q275R)
Ref Sequence ENSEMBL: ENSMUSP00000033230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033230] [ENSMUST00000093905]
Predicted Effect probably damaging
Transcript: ENSMUST00000033230
AA Change: Q275R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033230
Gene: ENSMUSG00000017713
AA Change: Q275R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Beta_elim_lyase 42 334 4.6e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093905
SMART Domains Protein: ENSMUSP00000091432
Gene: ENSMUSG00000070330

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 190 9.7e-14 PFAM
Pfam:Claudin_2 16 192 1.3e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Tha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Tha1 APN 11 117871005 splice site probably benign
IGL01434:Tha1 APN 11 117868599 missense probably benign 0.31
IGL01658:Tha1 APN 11 117871612 missense probably damaging 1.00
R0437:Tha1 UTSW 11 117868575 missense probably benign 0.17
R0671:Tha1 UTSW 11 117873157 splice site probably benign
R1958:Tha1 UTSW 11 117869353 unclassified probably benign
R2127:Tha1 UTSW 11 117869774 missense probably damaging 0.98
R3416:Tha1 UTSW 11 117873200 missense possibly damaging 0.67
R4825:Tha1 UTSW 11 117869379 missense probably damaging 1.00
R5145:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5266:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5267:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5339:Tha1 UTSW 11 117871082 missense possibly damaging 0.87
R5858:Tha1 UTSW 11 117873384 missense unknown
R6820:Tha1 UTSW 11 117871678 missense probably benign 0.00
R7399:Tha1 UTSW 11 117869690 missense possibly damaging 0.86
R7905:Tha1 UTSW 11 117871067 missense possibly damaging 0.91
R7988:Tha1 UTSW 11 117871067 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGACTCTTGGGGTGCAGATC -3'
(R):5'- GTTTCTCTAAGGTAGGCTGTCCTTC -3'

Sequencing Primer
(F):5'- GCACCTTTAGCGAATCTC -3'
(R):5'- AGCCTGACAGACCTGCTTG -3'
Posted On2019-11-12