Incidental Mutation 'R7706:Sucla2'
ID594295
Institutional Source Beutler Lab
Gene Symbol Sucla2
Ensembl Gene ENSMUSG00000022110
Gene Namesuccinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms4930547K18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_011506; MGI: 1306775

Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location73525319-73596142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73568993 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 168 (Y168C)
Ref Sequence ENSEMBL: ENSMUSP00000022706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022706] [ENSMUST00000160507]
Predicted Effect probably damaging
Transcript: ENSMUST00000022706
AA Change: Y168C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022706
Gene: ENSMUSG00000022110
AA Change: Y168C

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 1.6e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.2e-78 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160507
AA Change: Y168C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123765
Gene: ENSMUSG00000022110
AA Change: Y168C

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 3e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.5e-77 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Succinyl-CoA synthetase (SCS) is a mitochondrial matrix enzyme that acts as a heterodimer, being composed of an invariant alpha subunit and a substrate-specific beta subunit. The protein encoded by this gene is an ATP-specific SCS beta subunit that dimerizes with the SCS alpha subunit to form SCS-A, an essential component of the tricarboxylic acid cycle. SCS-A hydrolyzes ATP to convert succinate to succinyl-CoA. Defects in this gene are a cause of myopathic mitochondrial DNA depletion syndrome. A pseudogene of this gene has been found on chromosome 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit perinatal lethality with reduced size, placenta mineralization, decreased mitochondrial DNA and respiration. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Sucla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sucla2 APN 14 73590907 missense possibly damaging 0.81
IGL01539:Sucla2 APN 14 73591121 missense probably damaging 0.97
IGL02064:Sucla2 APN 14 73579473 nonsense probably null
IGL02240:Sucla2 APN 14 73590847 missense probably damaging 1.00
IGL02640:Sucla2 APN 14 73581806 missense probably benign 0.45
IGL02965:Sucla2 APN 14 73579431 missense probably benign 0.00
3-1:Sucla2 UTSW 14 73568957 nonsense probably null
PIT4812001:Sucla2 UTSW 14 73579449 missense possibly damaging 0.89
R0189:Sucla2 UTSW 14 73592648 missense probably damaging 1.00
R0764:Sucla2 UTSW 14 73560634 unclassified probably benign
R0765:Sucla2 UTSW 14 73560634 unclassified probably benign
R0844:Sucla2 UTSW 14 73560634 unclassified probably benign
R1065:Sucla2 UTSW 14 73560634 unclassified probably benign
R1067:Sucla2 UTSW 14 73560634 unclassified probably benign
R1136:Sucla2 UTSW 14 73560634 unclassified probably benign
R1162:Sucla2 UTSW 14 73560634 unclassified probably benign
R1311:Sucla2 UTSW 14 73560634 unclassified probably benign
R1312:Sucla2 UTSW 14 73560634 unclassified probably benign
R1345:Sucla2 UTSW 14 73560634 unclassified probably benign
R1416:Sucla2 UTSW 14 73560634 unclassified probably benign
R1677:Sucla2 UTSW 14 73592681 missense probably damaging 1.00
R1968:Sucla2 UTSW 14 73593679 missense probably damaging 0.99
R2126:Sucla2 UTSW 14 73592668 missense possibly damaging 0.71
R2484:Sucla2 UTSW 14 73581709 missense probably benign 0.12
R2566:Sucla2 UTSW 14 73552804 intron probably benign
R3706:Sucla2 UTSW 14 73591052 missense probably damaging 1.00
R4725:Sucla2 UTSW 14 73568989 missense possibly damaging 0.94
R5620:Sucla2 UTSW 14 73595396 missense probably damaging 0.99
R5650:Sucla2 UTSW 14 73591129 missense probably benign 0.38
R5947:Sucla2 UTSW 14 73592669 missense probably damaging 1.00
R6045:Sucla2 UTSW 14 73568964 nonsense probably null
R6236:Sucla2 UTSW 14 73593750 missense probably benign 0.39
R6693:Sucla2 UTSW 14 73568667 nonsense probably null
R8786:Sucla2 UTSW 14 73560465 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACACTGAGCGTTACCTGTG -3'
(R):5'- ACAGTGGAATTCCCCTATCGC -3'

Sequencing Primer
(F):5'- ACTGAGCGTTACCTGTGGTGTAG -3'
(R):5'- AGTGGAATTCCCCTATCGCTTTTTAG -3'
Posted On2019-11-12