Incidental Mutation 'R7706:Parn'
ID 594305
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Name poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms DAN, 1200003I18Rik
MMRRC Submission 045767-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R7706 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 13355828-13486035 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13425117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 432 (D432G)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000058884
AA Change: D432G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: D432G

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231003
Meta Mutation Damage Score 0.5967 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 46,044,583 (GRCm39) T46I unknown Het
Arhgef1 G A 7: 24,616,306 (GRCm39) D317N probably damaging Het
Atxn7l2 T C 3: 108,114,719 (GRCm39) D109G probably damaging Het
B4galnt3 C A 6: 120,195,913 (GRCm39) V305L probably benign Het
C9 T A 15: 6,488,402 (GRCm39) N85K probably benign Het
Cacna1g T C 11: 94,305,867 (GRCm39) I1941V probably benign Het
Capn15 A G 17: 26,183,125 (GRCm39) V518A probably benign Het
Chst10 A T 1: 38,905,106 (GRCm39) Y200N probably damaging Het
Ciao3 T C 17: 26,001,226 (GRCm39) *493Q probably null Het
Cir1 A G 2: 73,142,823 (GRCm39) S4P probably damaging Het
Cish G A 9: 107,177,840 (GRCm39) R172Q probably benign Het
Cnot10 A T 9: 114,422,506 (GRCm39) N693K probably damaging Het
Ddx6 A G 9: 44,538,939 (GRCm39) D249G probably damaging Het
Dennd6b T C 15: 89,069,447 (GRCm39) D528G probably benign Het
Dmtf1 T A 5: 9,174,489 (GRCm39) T484S possibly damaging Het
Dnaaf5 T C 5: 139,138,596 (GRCm39) V259A probably damaging Het
Dzip1l A T 9: 99,519,589 (GRCm39) S39C probably damaging Het
Efcab8 T A 2: 153,623,695 (GRCm39) M60K Het
Eml2 T A 7: 18,920,035 (GRCm39) V113D possibly damaging Het
Fnip1 A T 11: 54,406,325 (GRCm39) I1141F probably benign Het
Gm7298 T A 6: 121,712,570 (GRCm39) S127R probably damaging Het
Hcn2 G A 10: 79,570,017 (GRCm39) R622Q possibly damaging Het
Ift172 C T 5: 31,423,723 (GRCm39) W746* probably null Het
Irs1 A G 1: 82,265,412 (GRCm39) Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Klhl20 T C 1: 160,936,827 (GRCm39) I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lalba T C 15: 98,379,474 (GRCm39) D103G probably damaging Het
Lpin3 T C 2: 160,747,210 (GRCm39) L822P probably damaging Het
Lrrc38 G A 4: 143,076,845 (GRCm39) C36Y probably damaging Het
Ly6e T C 15: 74,830,183 (GRCm39) S46P possibly damaging Het
Nav2 T C 7: 49,244,067 (GRCm39) I2098T probably benign Het
Nipbl T C 15: 8,381,010 (GRCm39) E594G probably benign Het
Or52k2 T A 7: 102,253,853 (GRCm39) H97Q probably benign Het
Pcdh20 A G 14: 88,704,793 (GRCm39) S836P probably damaging Het
Pcmtd2 C T 2: 181,496,868 (GRCm39) R282C probably damaging Het
Ppp2r3c A G 12: 55,328,490 (GRCm39) I425T probably benign Het
Samm50 T A 15: 84,085,081 (GRCm39) probably null Het
Sars1 C T 3: 108,338,780 (GRCm39) probably null Het
Senp8 A G 9: 59,645,121 (GRCm39) Y12H possibly damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Srr T G 11: 74,803,961 (GRCm39) probably null Het
Steap2 T A 5: 5,732,967 (GRCm39) N19I possibly damaging Het
Sucla2 A G 14: 73,806,433 (GRCm39) Y168C probably damaging Het
Tha1 T C 11: 117,760,281 (GRCm39) Q275R probably damaging Het
Trim56 T C 5: 137,143,510 (GRCm39) N2S probably benign Het
Tubgcp6 T A 15: 88,988,426 (GRCm39) H849L probably benign Het
Uevld A G 7: 46,597,775 (GRCm39) I72T possibly damaging Het
Ybx1 A G 4: 119,136,164 (GRCm39) *323Q probably null Het
Zfp354b C T 11: 50,819,390 (GRCm39) probably null Het
Zfp36l2 A T 17: 84,494,346 (GRCm39) L97Q probably benign Het
Zfp729a T A 13: 67,771,612 (GRCm39) R78S possibly damaging Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13,485,467 (GRCm39) missense probably benign
IGL02030:Parn APN 16 13,482,514 (GRCm39) splice site probably null
IGL02179:Parn APN 16 13,485,456 (GRCm39) missense probably benign 0.00
IGL02336:Parn APN 16 13,384,567 (GRCm39) missense probably damaging 1.00
arlette UTSW 16 13,424,035 (GRCm39) missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13,425,145 (GRCm39) missense probably benign 0.00
PIT4651001:Parn UTSW 16 13,449,431 (GRCm39) missense probably benign 0.25
R0388:Parn UTSW 16 13,472,340 (GRCm39) missense possibly damaging 0.72
R0485:Parn UTSW 16 13,472,299 (GRCm39) splice site probably benign
R0625:Parn UTSW 16 13,458,158 (GRCm39) missense probably benign 0.02
R1104:Parn UTSW 16 13,485,449 (GRCm39) missense probably damaging 0.99
R1299:Parn UTSW 16 13,482,593 (GRCm39) missense probably benign 0.10
R1356:Parn UTSW 16 13,468,538 (GRCm39) nonsense probably null
R2067:Parn UTSW 16 13,420,933 (GRCm39) missense probably damaging 1.00
R2111:Parn UTSW 16 13,420,933 (GRCm39) missense probably damaging 1.00
R2397:Parn UTSW 16 13,384,518 (GRCm39) missense probably benign
R4473:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4474:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4475:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4476:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4665:Parn UTSW 16 13,358,967 (GRCm39) missense probably benign 0.19
R4795:Parn UTSW 16 13,424,066 (GRCm39) missense probably benign 0.06
R5122:Parn UTSW 16 13,472,311 (GRCm39) critical splice donor site probably null
R5226:Parn UTSW 16 13,443,416 (GRCm39) missense probably benign
R5355:Parn UTSW 16 13,485,886 (GRCm39) missense possibly damaging 0.92
R5570:Parn UTSW 16 13,483,794 (GRCm39) missense probably damaging 0.98
R5979:Parn UTSW 16 13,424,035 (GRCm39) missense probably damaging 1.00
R6009:Parn UTSW 16 13,485,428 (GRCm39) missense probably damaging 1.00
R6173:Parn UTSW 16 13,469,675 (GRCm39) missense possibly damaging 0.82
R6493:Parn UTSW 16 13,474,789 (GRCm39) missense probably damaging 1.00
R7055:Parn UTSW 16 13,443,998 (GRCm39) missense possibly damaging 0.80
R7278:Parn UTSW 16 13,443,927 (GRCm39) splice site probably null
R7391:Parn UTSW 16 13,485,870 (GRCm39) splice site probably null
R8188:Parn UTSW 16 13,359,020 (GRCm39) missense probably benign 0.01
R8317:Parn UTSW 16 13,358,964 (GRCm39) missense probably damaging 0.96
R8326:Parn UTSW 16 13,483,835 (GRCm39) missense probably benign 0.00
R8419:Parn UTSW 16 13,466,338 (GRCm39) missense probably benign 0.11
R8433:Parn UTSW 16 13,485,413 (GRCm39) missense probably damaging 1.00
R8475:Parn UTSW 16 13,425,113 (GRCm39) critical splice donor site probably null
R8847:Parn UTSW 16 13,446,270 (GRCm39) nonsense probably null
R8958:Parn UTSW 16 13,466,322 (GRCm39) missense possibly damaging 0.64
R8988:Parn UTSW 16 13,466,281 (GRCm39) critical splice donor site probably null
R9277:Parn UTSW 16 13,482,519 (GRCm39) critical splice donor site probably null
R9476:Parn UTSW 16 13,358,942 (GRCm39) missense probably benign 0.10
R9510:Parn UTSW 16 13,358,942 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTAACAAAGGCCCAAGGTCTC -3'
(R):5'- GGACAGACTTCTTTCAACACTTC -3'

Sequencing Primer
(F):5'- GGCCCAAGGTCTCATGAAC -3'
(R):5'- GCAAGTAGCTTCTACTAACATTTTA -3'
Posted On 2019-11-12