Mutagenetix > Incidental Mutation

Incidental Mutation 'R7706:Parn'

594305

Institutional Source

Beutler Lab

Gene Symbol

Parn

Ensembl Gene

ENSMUSG00000022685

Gene Name

poly(A)-specific ribonuclease (deadenylation nuclease)

Synonyms

DAN, 1200003I18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R7706 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13537960-13668170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13607253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 432 (D432G)

Ref Sequence

ENSEMBL: ENSMUSP00000055969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000058884
AA Change: D432G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: D432G

Domain	Start	End	E-Value	Type
Pfam:CAF1	3	383	2.7e-86	PFAM
Pfam:R3H	172	236	2.8e-13	PFAM
Pfam:RNA_bind	430	508	2.2e-37	PFAM
low complexity region	564	578	N/A	INTRINSIC
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231003

Meta Mutation Damage Score

0.5967

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	G	A	17: 45,733,657	T46I	unknown	Het
Arhgef1	G	A	7: 24,916,881	D317N	probably damaging	Het
Atxn7l2	T	C	3: 108,207,403	D109G	probably damaging	Het
B4galnt3	C	A	6: 120,218,952	V305L	probably benign	Het
C9	T	A	15: 6,458,921	N85K	probably benign	Het
Cacna1g	T	C	11: 94,415,041	I1941V	probably benign	Het
Capn15	A	G	17: 25,964,151	V518A	probably benign	Het
Chst10	A	T	1: 38,866,025	Y200N	probably damaging	Het
Cir1	A	G	2: 73,312,479	S4P	probably damaging	Het
Cish	G	A	9: 107,300,641	R172Q	probably benign	Het
Cnot10	A	T	9: 114,593,438	N693K	probably damaging	Het
Ddx6	A	G	9: 44,627,642	D249G	probably damaging	Het
Dennd6b	T	C	15: 89,185,244	D528G	probably benign	Het
Dmtf1	T	A	5: 9,124,489	T484S	possibly damaging	Het
Dnaaf5	T	C	5: 139,152,841	V259A	probably damaging	Het
Dzip1l	A	T	9: 99,637,536	S39C	probably damaging	Het
Efcab8	T	A	2: 153,781,775	M60K		Het
Eml2	T	A	7: 19,186,110	V113D	possibly damaging	Het
Fnip1	A	T	11: 54,515,499	I1141F	probably benign	Het
Gm7298	T	A	6: 121,735,611	S127R	probably damaging	Het
Hcn2	G	A	10: 79,734,183	R622Q	possibly damaging	Het
Ift172	C	T	5: 31,266,379	W746*	probably null	Het
Irs1	A	G	1: 82,287,691	Y935H	probably damaging	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Klhl20	T	C	1: 161,109,257	I183V	probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lalba	T	C	15: 98,481,593	D103G	probably damaging	Het
Lpin3	T	C	2: 160,905,290	L822P	probably damaging	Het
Lrrc38	G	A	4: 143,350,275	C36Y	probably damaging	Het
Ly6e	T	C	15: 74,958,334	S46P	possibly damaging	Het
Narfl	T	C	17: 25,782,252	*493Q	probably null	Het
Nav2	T	C	7: 49,594,319	I2098T	probably benign	Het
Nipbl	T	C	15: 8,351,526	E594G	probably benign	Het
Olfr552	T	A	7: 102,604,646	H97Q	probably benign	Het
Pcdh20	A	G	14: 88,467,357	S836P	probably damaging	Het
Pcmtd2	C	T	2: 181,855,075	R282C	probably damaging	Het
Ppp2r3c	A	G	12: 55,281,705	I425T	probably benign	Het
Samm50	T	A	15: 84,200,880		probably null	Het
Sars	C	T	3: 108,431,464		probably null	Het
Senp8	A	G	9: 59,737,838	Y12H	possibly damaging	Het
Slc13a4	T	C	6: 35,270,355	I577V	possibly damaging	Het
Srr	T	G	11: 74,913,135		probably null	Het
Steap2	T	A	5: 5,682,967	N19I	possibly damaging	Het
Sucla2	A	G	14: 73,568,993	Y168C	probably damaging	Het
Tha1	T	C	11: 117,869,455	Q275R	probably damaging	Het
Trim56	T	C	5: 137,114,656	N2S	probably benign	Het
Tubgcp6	T	A	15: 89,104,223	H849L	probably benign	Het
Uevld	A	G	7: 46,948,027	I72T	possibly damaging	Het
Ybx1	A	G	4: 119,278,967	*323Q	probably null	Het
Zfp354b	C	T	11: 50,928,563		probably null	Het
Zfp36l2	A	T	17: 84,186,918	L97Q	probably benign	Het
Zfp729a	T	A	13: 67,623,493	R78S	possibly damaging	Het

Other mutations in Parn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Parn	APN	16	13667603	missense	probably benign
IGL02030:Parn	APN	16	13664650	splice site	probably null
IGL02179:Parn	APN	16	13667592	missense	probably benign	0.00
IGL02336:Parn	APN	16	13566703	missense	probably damaging	1.00
arlette	UTSW	16	13606171	missense	probably damaging	1.00
PIT4453001:Parn	UTSW	16	13607281	missense	probably benign	0.00
PIT4651001:Parn	UTSW	16	13631567	missense	probably benign	0.25
R0388:Parn	UTSW	16	13654476	missense	possibly damaging	0.72
R0485:Parn	UTSW	16	13654435	splice site	probably benign
R0625:Parn	UTSW	16	13640294	missense	probably benign	0.02
R1104:Parn	UTSW	16	13667585	missense	probably damaging	0.99
R1299:Parn	UTSW	16	13664729	missense	probably benign	0.10
R1356:Parn	UTSW	16	13650674	nonsense	probably null
R2067:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2111:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2397:Parn	UTSW	16	13566654	missense	probably benign
R4473:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4474:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4475:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4476:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4665:Parn	UTSW	16	13541103	missense	probably benign	0.19
R4795:Parn	UTSW	16	13606202	missense	probably benign	0.06
R5122:Parn	UTSW	16	13654447	critical splice donor site	probably null
R5226:Parn	UTSW	16	13625552	missense	probably benign
R5355:Parn	UTSW	16	13668022	missense	possibly damaging	0.92
R5570:Parn	UTSW	16	13665930	missense	probably damaging	0.98
R5979:Parn	UTSW	16	13606171	missense	probably damaging	1.00
R6009:Parn	UTSW	16	13667564	missense	probably damaging	1.00
R6173:Parn	UTSW	16	13651811	missense	possibly damaging	0.82
R6493:Parn	UTSW	16	13656925	missense	probably damaging	1.00
R7055:Parn	UTSW	16	13626134	missense	possibly damaging	0.80
R7278:Parn	UTSW	16	13626063	splice site	probably null
R7391:Parn	UTSW	16	13668006	splice site	probably null
R8188:Parn	UTSW	16	13541156	missense	probably benign	0.01
R8317:Parn	UTSW	16	13541100	missense	probably damaging	0.96
R8326:Parn	UTSW	16	13665971	missense	probably benign	0.00
R8419:Parn	UTSW	16	13648474	missense	probably benign	0.11
R8433:Parn	UTSW	16	13667549	missense	probably damaging	1.00
R8475:Parn	UTSW	16	13607249	critical splice donor site	probably null
R8847:Parn	UTSW	16	13628406	nonsense	probably null
R8958:Parn	UTSW	16	13648458	missense	possibly damaging	0.64
R8988:Parn	UTSW	16	13648417	critical splice donor site	probably null
R9277:Parn	UTSW	16	13664655	critical splice donor site	probably null
R9476:Parn	UTSW	16	13541078	missense	probably benign	0.10
R9510:Parn	UTSW	16	13541078	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TTAACAAAGGCCCAAGGTCTC -3'
(R):5'- GGACAGACTTCTTTCAACACTTC -3'

Sequencing Primer
(F):5'- GGCCCAAGGTCTCATGAAC -3'
(R):5'- GCAAGTAGCTTCTACTAACATTTTA -3'

Posted On

2019-11-12