Incidental Mutation 'R7706:Narfl'
ID594306
Institutional Source Beutler Lab
Gene Symbol Narfl
Ensembl Gene ENSMUSG00000002280
Gene Namenuclear prelamin A recognition factor-like
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25773776-25783332 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 25782252 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 493 (*493Q)
Ref Sequence ENSEMBL: ENSMUSP00000117136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002350] [ENSMUST00000077938] [ENSMUST00000095500] [ENSMUST00000131458] [ENSMUST00000133071] [ENSMUST00000134108] [ENSMUST00000138759] [ENSMUST00000140738] [ENSMUST00000145053] [ENSMUST00000150324]
Predicted Effect probably null
Transcript: ENSMUST00000002350
AA Change: *477Q
SMART Domains Protein: ENSMUSP00000002350
Gene: ENSMUSG00000002280
AA Change: *477Q

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 406 8.5e-95 PFAM
Fe_hyd_SSU 410 466 9.56e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077938
SMART Domains Protein: ENSMUSP00000077091
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131458
SMART Domains Protein: ENSMUSP00000120281
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133071
SMART Domains Protein: ENSMUSP00000120885
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000134108
AA Change: *493Q
SMART Domains Protein: ENSMUSP00000117136
Gene: ENSMUSG00000002280
AA Change: *493Q

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 422 4e-85 PFAM
Fe_hyd_SSU 426 482 9.56e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138759
SMART Domains Protein: ENSMUSP00000115538
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140738
SMART Domains Protein: ENSMUSP00000116841
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145053
SMART Domains Protein: ENSMUSP00000114961
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Pfam:Lactamase_B 7 113 3.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150324
SMART Domains Protein: ENSMUSP00000119647
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Meta Mutation Damage Score 0.9040 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted knock-out die before E10.5. Mice heterozygous for a targeted allele exhibit partial lethality between E10.5 and birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Narfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Narfl APN 17 25780320 missense possibly damaging 0.83
IGL02266:Narfl APN 17 25780326 missense possibly damaging 0.91
IGL02537:Narfl APN 17 25778942 unclassified probably benign
IGL02926:Narfl APN 17 25782154 missense probably benign
napoleon UTSW 17 25782252 makesense probably null
R0097:Narfl UTSW 17 25777002 missense possibly damaging 0.94
R0097:Narfl UTSW 17 25777002 missense possibly damaging 0.94
R0723:Narfl UTSW 17 25781821 missense probably damaging 1.00
R1219:Narfl UTSW 17 25775101 missense probably damaging 1.00
R1370:Narfl UTSW 17 25776988 missense probably benign 0.24
R4737:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4739:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4740:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4747:Narfl UTSW 17 25780353 missense probably benign 0.04
R4826:Narfl UTSW 17 25780332 missense probably damaging 1.00
R5382:Narfl UTSW 17 25776920 unclassified probably benign
R5789:Narfl UTSW 17 25781203 missense probably benign
R7275:Narfl UTSW 17 25775134 missense possibly damaging 0.94
R7576:Narfl UTSW 17 25778970 missense probably damaging 1.00
R7615:Narfl UTSW 17 25782129 missense probably benign 0.01
R7911:Narfl UTSW 17 25780398 missense probably benign 0.16
R7992:Narfl UTSW 17 25780398 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGCTGGAAAGACTGTACAGC -3'
(R):5'- TGGGCTGCAGGCAACATTAC -3'

Sequencing Primer
(F):5'- CTGTACAGCATGGTGAGGACTG -3'
(R):5'- TTACCAGCCAGAGACATGGGTC -3'
Posted On2019-11-12