Incidental Mutation 'R7706:Capn15'
ID594307
Institutional Source Beutler Lab
Gene Symbol Capn15
Ensembl Gene ENSMUSG00000037326
Gene Namecalpain 15
SynonymsSolh
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25958364-25985796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25964151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 518 (V518A)
Ref Sequence ENSEMBL: ENSMUSP00000148486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041641] [ENSMUST00000181174] [ENSMUST00000212099] [ENSMUST00000212149] [ENSMUST00000212520] [ENSMUST00000212789]
Predicted Effect probably benign
Transcript: ENSMUST00000041641
AA Change: V452A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039528
Gene: ENSMUSG00000037326
AA Change: V452A

DomainStartEndE-ValueType
ZnF_RBZ 5 29 8.92e-8 SMART
ZnF_RBZ 46 70 3.46e-5 SMART
low complexity region 117 150 N/A INTRINSIC
ZnF_RBZ 151 175 2.28e-5 SMART
low complexity region 184 196 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 280 301 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
ZnF_RBZ 352 376 1.21e-4 SMART
ZnF_RBZ 424 448 4.78e-8 SMART
CysPc 479 811 6.54e-132 SMART
low complexity region 868 879 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 972 981 N/A INTRINSIC
Blast:CysPc 982 1028 9e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181174
Predicted Effect probably benign
Transcript: ENSMUST00000212099
AA Change: V452A

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000212149
AA Change: V452A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212520
AA Change: V518A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000212789
AA Change: V452A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc-finger-like repeats and a calpain-like protease domain. The encoded protein may function as a transcription factor, RNA-binding protein, or in protein-protein interactions during visual system development. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Capn15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Capn15 APN 17 25963050 missense probably damaging 1.00
IGL01568:Capn15 APN 17 25965445 missense probably damaging 0.99
IGL01724:Capn15 APN 17 25962063 missense probably damaging 1.00
IGL01934:Capn15 APN 17 25963024 missense probably damaging 1.00
IGL02700:Capn15 APN 17 25963008 missense probably damaging 1.00
IGL03274:Capn15 APN 17 25961838 missense probably damaging 1.00
ANU74:Capn15 UTSW 17 25965486 nonsense probably null
R1350:Capn15 UTSW 17 25964692 missense probably benign 0.00
R1491:Capn15 UTSW 17 25964479 missense probably damaging 1.00
R1632:Capn15 UTSW 17 25960665 missense probably damaging 0.99
R1696:Capn15 UTSW 17 25964904 missense probably benign 0.01
R1871:Capn15 UTSW 17 25964229 missense probably damaging 1.00
R1914:Capn15 UTSW 17 25964863 missense probably benign 0.03
R2295:Capn15 UTSW 17 25964581 nonsense probably null
R4579:Capn15 UTSW 17 25959837 missense probably damaging 0.99
R4658:Capn15 UTSW 17 25960768 missense probably benign 0.11
R5790:Capn15 UTSW 17 25964547 missense probably benign 0.08
R6455:Capn15 UTSW 17 25965436 missense probably damaging 1.00
R6639:Capn15 UTSW 17 25960178 missense probably benign 0.00
R6882:Capn15 UTSW 17 25960179 splice site probably null
R7052:Capn15 UTSW 17 25961750 missense probably damaging 1.00
R7157:Capn15 UTSW 17 25965254 missense probably damaging 1.00
R7287:Capn15 UTSW 17 25960455 missense probably damaging 1.00
R7553:Capn15 UTSW 17 25960764 missense probably damaging 0.96
R7555:Capn15 UTSW 17 25963432 missense probably damaging 1.00
Z1088:Capn15 UTSW 17 25963347 missense probably damaging 1.00
Z1177:Capn15 UTSW 17 25973220 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACCTTGGGCAAAGCTGGTTC -3'
(R):5'- CTCCAAGCTGCATGGTTTCC -3'

Sequencing Primer
(F):5'- CTGGTTCTCAGCCTCAAAAAC -3'
(R):5'- GTTTCCAGGAGCACAGTGAACC -3'
Posted On2019-11-12