Incidental Mutation 'R7706:Zfp36l2'
ID594309
Institutional Source Beutler Lab
Gene Symbol Zfp36l2
Ensembl Gene ENSMUSG00000045817
Gene Namezinc finger protein 36, C3H type-like 2
SynonymsBrf2, Tis11d, ERF2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location84183931-84187947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84186918 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 97 (L97Q)
Ref Sequence ENSEMBL: ENSMUSP00000050820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524] [ENSMUST00000060366]
Predicted Effect probably benign
Transcript: ENSMUST00000047524
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060366
AA Change: L97Q

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050820
Gene: ENSMUSG00000045817
AA Change: L97Q

DomainStartEndE-ValueType
Pfam:Tis11B_N 1 144 1.5e-43 PFAM
ZnF_C3H1 155 182 9.8e-9 SMART
ZnF_C3H1 193 220 2.1e-8 SMART
low complexity region 223 235 N/A INTRINSIC
low complexity region 286 340 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 436 470 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIS11 family of early response genes. Family members are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice expressing decreased levels of an amino-terminal truncated protein display female infertility whereas mice homozygous for a null allele die within two weeks as a result of hematopoietic system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Zfp36l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1219:Zfp36l2 UTSW 17 84187642 critical splice donor site probably null
R1918:Zfp36l2 UTSW 17 84186736 missense probably damaging 0.98
R2126:Zfp36l2 UTSW 17 84186975 missense probably damaging 0.99
R4727:Zfp36l2 UTSW 17 84187661 missense probably benign 0.07
R4915:Zfp36l2 UTSW 17 84186262 unclassified probably benign
R6213:Zfp36l2 UTSW 17 84186552 missense probably damaging 0.98
R6814:Zfp36l2 UTSW 17 84186093 unclassified probably benign
R7011:Zfp36l2 UTSW 17 84186433 missense possibly damaging 0.61
R7455:Zfp36l2 UTSW 17 84187147 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCACAGCTCTGTCTTGTAC -3'
(R):5'- CTGAACAACATGCTGGACAAG -3'

Sequencing Primer
(F):5'- ACAGCTCCGTCTTGTAGCG -3'
(R):5'- CAACATGCTGGACAAGAAGGC -3'
Posted On2019-11-12