Incidental Mutation 'R7707:Wwp1'
ID594323
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7707 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19627645 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 750 (D750G)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably benign
Transcript: ENSMUST00000035982
AA Change: D750G

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: D750G

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108246
AA Change: D750G

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: D750G

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A T 8: 129,219,179 C388* probably null Het
2900026A02Rik T A 5: 113,137,986 M1L probably benign Het
Ap1s3 T C 1: 79,614,247 K129E probably benign Het
Ap3b2 C T 7: 81,476,782 V357I possibly damaging Het
Aplp1 A T 7: 30,443,098 C140S probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asb4 A G 6: 5,430,968 H401R probably benign Het
Bpi A T 2: 158,261,173 E79D probably benign Het
Cant1 C T 11: 118,410,898 V198M possibly damaging Het
Casp9 C T 4: 141,805,467 R225C probably benign Het
Ccdc88b C A 19: 6,857,469 R82L probably benign Het
Chrm4 A G 2: 91,927,354 T36A probably benign Het
Cntln A T 4: 84,884,616 D51V probably damaging Het
Commd8 A T 5: 72,162,738 F120Y probably damaging Het
Cpne6 A C 14: 55,516,314 T410P probably damaging Het
Ctnnb1 A T 9: 120,952,865 I315F possibly damaging Het
Dnah9 A G 11: 66,118,958 V701A probably damaging Het
Efcab9 A G 11: 32,522,851 Y199H possibly damaging Het
Endou T A 15: 97,713,102 probably null Het
Fam160a1 A G 3: 85,676,253 V412A probably benign Het
Foxc2 C T 8: 121,117,902 P430S probably benign Het
Gas2l3 T A 10: 89,414,358 K299N probably damaging Het
Gm10375 G A 14: 43,604,875 Q133* probably null Het
Gorab T C 1: 163,392,440 D211G probably damaging Het
Grin3b T A 10: 79,975,901 S747T possibly damaging Het
Gucd1 C A 10: 75,511,286 probably benign Het
Gucy2d T C 7: 98,451,669 F400L possibly damaging Het
Hivep3 G A 4: 119,733,959 V55M Het
Igsf3 A G 3: 101,459,922 N1157S probably benign Het
Irak3 A T 10: 120,146,584 D324E probably damaging Het
Jup G T 11: 100,383,052 A221D possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr4 A G 2: 109,997,591 probably null Het
Lrrc34 T C 3: 30,624,892 D352G probably benign Het
Metrn C A 17: 25,795,410 A175S probably benign Het
Nr2c1 T A 10: 94,188,165 S411T probably benign Het
Olfr1206 A G 2: 88,864,809 D68G possibly damaging Het
Olfr190 T A 16: 59,074,271 I270F possibly damaging Het
Orc3 T A 4: 34,598,691 K172* probably null Het
Oxnad1 A G 14: 32,102,008 probably null Het
Pcdh7 A G 5: 57,720,330 N409S probably damaging Het
Pcdha11 A T 18: 37,011,792 N312I probably benign Het
Pds5a G T 5: 65,610,133 P121Q unknown Het
Phc1 A G 6: 122,323,780 I380T unknown Het
Phldb3 C A 7: 24,626,597 H535N possibly damaging Het
Proser3 T C 7: 30,539,791 Q600R probably benign Het
Ptprz1 A G 6: 23,002,296 M1462V probably benign Het
Pyroxd2 T C 19: 42,738,147 T243A probably damaging Het
Ralgapa1 C A 12: 55,777,292 D268Y probably null Het
Rapgef5 A C 12: 117,715,344 Y419S probably damaging Het
Rbm24 C A 13: 46,429,129 Q175K possibly damaging Het
Robo4 A T 9: 37,413,122 D982V probably damaging Het
Sbf2 T C 7: 110,330,713 probably null Het
Serping1 A T 2: 84,773,699 probably null Het
Shank1 C T 7: 44,344,301 S798F unknown Het
Slc15a5 A T 6: 138,079,747 M57K probably damaging Het
Slc35g1 T A 19: 38,403,123 C284* probably null Het
Src G A 2: 157,464,658 D194N probably damaging Het
Srfbp1 A G 18: 52,483,654 T84A probably damaging Het
Sspo A T 6: 48,461,527 T1510S probably benign Het
Taar1 A T 10: 23,921,237 I278F possibly damaging Het
Taf1a T C 1: 183,404,429 Y281H possibly damaging Het
Thbs3 A T 3: 89,224,900 Y798F possibly damaging Het
Tnpo1 T C 13: 98,890,787 T7A probably benign Het
Traf7 A T 17: 24,510,709 probably null Het
Trbv19 G A 6: 41,178,613 V9I possibly damaging Het
Trim17 C T 11: 58,965,284 Q56* probably null Het
Ttn G T 2: 76,902,062 A4643E unknown Het
Ugt2b36 A G 5: 87,081,508 probably null Het
Uso1 A G 5: 92,201,936 *960W probably null Het
Usp2 G T 9: 44,073,460 probably null Het
Wdr20rt A G 12: 65,226,207 D148G probably damaging Het
Wdr66 A T 5: 123,253,887 E28V probably benign Het
Wif1 T C 10: 121,083,959 F204L probably damaging Het
Zmynd12 A T 4: 119,444,866 D234V probably damaging Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7947:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R8006:Wwp1 UTSW 4 19650174 missense probably benign
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CATGGGAAAGTGACTAACGATATGC -3'
(R):5'- ACTGTGTTTATATGCACACTCACAC -3'

Sequencing Primer
(F):5'- ACTCGAGCAGGATCTGGATC -3'
(R):5'- CTGTAGACATGGAGATTCTGG -3'
Posted On2019-11-12