Incidental Mutation 'R7707:Cntln'
ID 594325
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 067893-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R7707 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84802853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 51 (D51V)
Ref Sequence ENSEMBL: ENSMUSP00000099883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: D51V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: D51V

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102819
AA Change: D51V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: D51V

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: D51V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: D51V

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,285,852 (GRCm39) M1L probably benign Het
Ap1s3 T C 1: 79,591,964 (GRCm39) K129E probably benign Het
Ap3b2 C T 7: 81,126,530 (GRCm39) V357I possibly damaging Het
Aplp1 A T 7: 30,142,523 (GRCm39) C140S probably damaging Het
Arhgef1 G A 7: 24,616,306 (GRCm39) D317N probably damaging Het
Asb4 A G 6: 5,430,968 (GRCm39) H401R probably benign Het
Bpi A T 2: 158,103,093 (GRCm39) E79D probably benign Het
Cant1 C T 11: 118,301,724 (GRCm39) V198M possibly damaging Het
Casp9 C T 4: 141,532,778 (GRCm39) R225C probably benign Het
Ccdc88b C A 19: 6,834,837 (GRCm39) R82L probably benign Het
Cfap251 A T 5: 123,391,950 (GRCm39) E28V probably benign Het
Chrm4 A G 2: 91,757,699 (GRCm39) T36A probably benign Het
Commd8 A T 5: 72,320,081 (GRCm39) F120Y probably damaging Het
Cpne6 A C 14: 55,753,771 (GRCm39) T410P probably damaging Het
Ctnnb1 A T 9: 120,781,931 (GRCm39) I315F possibly damaging Het
Dnah9 A G 11: 66,009,784 (GRCm39) V701A probably damaging Het
Efcab9 A G 11: 32,472,851 (GRCm39) Y199H possibly damaging Het
Endou T A 15: 97,610,983 (GRCm39) probably null Het
Fhip1a A G 3: 85,583,560 (GRCm39) V412A probably benign Het
Foxc2 C T 8: 121,844,641 (GRCm39) P430S probably benign Het
Gas2l3 T A 10: 89,250,220 (GRCm39) K299N probably damaging Het
Gm10375 G A 14: 43,842,332 (GRCm39) Q133* probably null Het
Gorab T C 1: 163,220,009 (GRCm39) D211G probably damaging Het
Grin3b T A 10: 79,811,735 (GRCm39) S747T possibly damaging Het
Gucd1 C A 10: 75,347,120 (GRCm39) probably benign Het
Gucy2d T C 7: 98,100,876 (GRCm39) F400L possibly damaging Het
Hivep3 G A 4: 119,591,156 (GRCm39) V55M Het
Igsf3 A G 3: 101,367,238 (GRCm39) N1157S probably benign Het
Irak3 A T 10: 119,982,489 (GRCm39) D324E probably damaging Het
Jup G T 11: 100,273,878 (GRCm39) A221D possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Lgr4 A G 2: 109,827,936 (GRCm39) probably null Het
Lrrc34 T C 3: 30,679,041 (GRCm39) D352G probably benign Het
Metrn C A 17: 26,014,384 (GRCm39) A175S probably benign Het
Nr2c1 T A 10: 94,024,027 (GRCm39) S411T probably benign Het
Or4c11 A G 2: 88,695,153 (GRCm39) D68G possibly damaging Het
Or5h22 T A 16: 58,894,634 (GRCm39) I270F possibly damaging Het
Orc3 T A 4: 34,598,691 (GRCm39) K172* probably null Het
Oxnad1 A G 14: 31,823,965 (GRCm39) probably null Het
Pcdh7 A G 5: 57,877,672 (GRCm39) N409S probably damaging Het
Pcdha11 A T 18: 37,144,845 (GRCm39) N312I probably benign Het
Pds5a G T 5: 65,767,476 (GRCm39) P121Q unknown Het
Phc1 A G 6: 122,300,739 (GRCm39) I380T unknown Het
Phldb3 C A 7: 24,326,022 (GRCm39) H535N possibly damaging Het
Proser3 T C 7: 30,239,216 (GRCm39) Q600R probably benign Het
Ptprz1 A G 6: 23,002,295 (GRCm39) M1462V probably benign Het
Pyroxd2 T C 19: 42,726,586 (GRCm39) T243A probably damaging Het
Ralgapa1 C A 12: 55,824,077 (GRCm39) D268Y probably null Het
Rapgef5 A C 12: 117,679,079 (GRCm39) Y419S probably damaging Het
Rbm24 C A 13: 46,582,605 (GRCm39) Q175K possibly damaging Het
Robo4 A T 9: 37,324,418 (GRCm39) D982V probably damaging Het
Sbf2 T C 7: 109,929,920 (GRCm39) probably null Het
Serping1 A T 2: 84,604,043 (GRCm39) probably null Het
Shank1 C T 7: 43,993,725 (GRCm39) S798F unknown Het
Slc15a5 A T 6: 138,056,745 (GRCm39) M57K probably damaging Het
Slc35g1 T A 19: 38,391,571 (GRCm39) C284* probably null Het
Src G A 2: 157,306,578 (GRCm39) D194N probably damaging Het
Srfbp1 A G 18: 52,616,726 (GRCm39) T84A probably damaging Het
Sspo A T 6: 48,438,461 (GRCm39) T1510S probably benign Het
Taar1 A T 10: 23,797,135 (GRCm39) I278F possibly damaging Het
Taf1a T C 1: 183,185,583 (GRCm39) Y281H possibly damaging Het
Thbs3 A T 3: 89,132,207 (GRCm39) Y798F possibly damaging Het
Tnpo1 T C 13: 99,027,295 (GRCm39) T7A probably benign Het
Traf7 A T 17: 24,729,683 (GRCm39) probably null Het
Trbv19 G A 6: 41,155,547 (GRCm39) V9I possibly damaging Het
Trim17 C T 11: 58,856,110 (GRCm39) Q56* probably null Het
Ttn G T 2: 76,732,406 (GRCm39) A4643E unknown Het
Ugt2b36 A G 5: 87,229,367 (GRCm39) probably null Het
Uso1 A G 5: 92,349,795 (GRCm39) *960W probably null Het
Usp2 G T 9: 43,984,757 (GRCm39) probably null Het
Wdr20rt A G 12: 65,272,981 (GRCm39) D148G probably damaging Het
Wif1 T C 10: 120,919,864 (GRCm39) F204L probably damaging Het
Wwp1 T C 4: 19,627,645 (GRCm39) D750G probably benign Het
Zfp1006 A T 8: 129,945,660 (GRCm39) C388* probably null Het
Zmynd12 A T 4: 119,302,063 (GRCm39) D234V probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGTTTTCAAGCGGGAACTTG -3'
(R):5'- CCAGTCCTGATACCTGACAC -3'

Sequencing Primer
(F):5'- AACTTGACCCGTTAGGCG -3'
(R):5'- AGGGCCAGCTCCTCCTTTAG -3'
Posted On 2019-11-12