Mutagenetix > Incidental Mutations

Incidental Mutation 'R7707:Ap3b2'

594347

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R7707 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81476782 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 357 (V357I)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082090
AA Change: V357I

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: V357I

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152355
AA Change: V357I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610044O15Rik8	A	T	8: 129,219,179	C388*	probably null	Het
2900026A02Rik	T	A	5: 113,137,986	M1L	probably benign	Het
Ap1s3	T	C	1: 79,614,247	K129E	probably benign	Het
Aplp1	A	T	7: 30,443,098	C140S	probably damaging	Het
Arhgef1	G	A	7: 24,916,881	D317N	probably damaging	Het
Asb4	A	G	6: 5,430,968	H401R	probably benign	Het
Bpi	A	T	2: 158,261,173	E79D	probably benign	Het
Cant1	C	T	11: 118,410,898	V198M	possibly damaging	Het
Casp9	C	T	4: 141,805,467	R225C	probably benign	Het
Ccdc88b	C	A	19: 6,857,469	R82L	probably benign	Het
Chrm4	A	G	2: 91,927,354	T36A	probably benign	Het
Cntln	A	T	4: 84,884,616	D51V	probably damaging	Het
Commd8	A	T	5: 72,162,738	F120Y	probably damaging	Het
Cpne6	A	C	14: 55,516,314	T410P	probably damaging	Het
Ctnnb1	A	T	9: 120,952,865	I315F	possibly damaging	Het
Dnah9	A	G	11: 66,118,958	V701A	probably damaging	Het
Efcab9	A	G	11: 32,522,851	Y199H	possibly damaging	Het
Endou	T	A	15: 97,713,102		probably null	Het
Fam160a1	A	G	3: 85,676,253	V412A	probably benign	Het
Foxc2	C	T	8: 121,117,902	P430S	probably benign	Het
Gas2l3	T	A	10: 89,414,358	K299N	probably damaging	Het
Gm10375	G	A	14: 43,604,875	Q133*	probably null	Het
Gorab	T	C	1: 163,392,440	D211G	probably damaging	Het
Grin3b	T	A	10: 79,975,901	S747T	possibly damaging	Het
Gucd1	C	A	10: 75,511,286		probably benign	Het
Gucy2d	T	C	7: 98,451,669	F400L	possibly damaging	Het
Hivep3	G	A	4: 119,733,959	V55M		Het
Igsf3	A	G	3: 101,459,922	N1157S	probably benign	Het
Irak3	A	T	10: 120,146,584	D324E	probably damaging	Het
Jup	G	T	11: 100,383,052	A221D	possibly damaging	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Lgr4	A	G	2: 109,997,591		probably null	Het
Lrrc34	T	C	3: 30,624,892	D352G	probably benign	Het
Metrn	C	A	17: 25,795,410	A175S	probably benign	Het
Nr2c1	T	A	10: 94,188,165	S411T	probably benign	Het
Olfr1206	A	G	2: 88,864,809	D68G	possibly damaging	Het
Olfr190	T	A	16: 59,074,271	I270F	possibly damaging	Het
Orc3	T	A	4: 34,598,691	K172*	probably null	Het
Oxnad1	A	G	14: 32,102,008		probably null	Het
Pcdh7	A	G	5: 57,720,330	N409S	probably damaging	Het
Pcdha11	A	T	18: 37,011,792	N312I	probably benign	Het
Pds5a	G	T	5: 65,610,133	P121Q	unknown	Het
Phc1	A	G	6: 122,323,780	I380T	unknown	Het
Phldb3	C	A	7: 24,626,597	H535N	possibly damaging	Het
Proser3	T	C	7: 30,539,791	Q600R	probably benign	Het
Ptprz1	A	G	6: 23,002,296	M1462V	probably benign	Het
Pyroxd2	T	C	19: 42,738,147	T243A	probably damaging	Het
Ralgapa1	C	A	12: 55,777,292	D268Y	probably null	Het
Rapgef5	A	C	12: 117,715,344	Y419S	probably damaging	Het
Rbm24	C	A	13: 46,429,129	Q175K	possibly damaging	Het
Robo4	A	T	9: 37,413,122	D982V	probably damaging	Het
Sbf2	T	C	7: 110,330,713		probably null	Het
Serping1	A	T	2: 84,773,699		probably null	Het
Shank1	C	T	7: 44,344,301	S798F	unknown	Het
Slc15a5	A	T	6: 138,079,747	M57K	probably damaging	Het
Slc35g1	T	A	19: 38,403,123	C284*	probably null	Het
Src	G	A	2: 157,464,658	D194N	probably damaging	Het
Srfbp1	A	G	18: 52,483,654	T84A	probably damaging	Het
Sspo	A	T	6: 48,461,527	T1510S	probably benign	Het
Taar1	A	T	10: 23,921,237	I278F	possibly damaging	Het
Taf1a	T	C	1: 183,404,429	Y281H	possibly damaging	Het
Thbs3	A	T	3: 89,224,900	Y798F	possibly damaging	Het
Tnpo1	T	C	13: 98,890,787	T7A	probably benign	Het
Traf7	A	T	17: 24,510,709		probably null	Het
Trbv19	G	A	6: 41,178,613	V9I	possibly damaging	Het
Trim17	C	T	11: 58,965,284	Q56*	probably null	Het
Ttn	G	T	2: 76,902,062	A4643E	unknown	Het
Ugt2b36	A	G	5: 87,081,508		probably null	Het
Uso1	A	G	5: 92,201,936	*960W	probably null	Het
Usp2	G	T	9: 44,073,460		probably null	Het
Wdr20rt	A	G	12: 65,226,207	D148G	probably damaging	Het
Wdr66	A	T	5: 123,253,887	E28V	probably benign	Het
Wif1	T	C	10: 121,083,959	F204L	probably damaging	Het
Wwp1	T	C	4: 19,627,645	D750G	probably benign	Het
Zmynd12	A	T	4: 119,444,866	D234V	probably damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	intron	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGCCCCTTCAGGATCTAGAC -3'
(R):5'- TACTTCCACCTAGCGCCTAAGG -3'

Sequencing Primer
(F):5'- TTCAGGATCTAGACCCGGCTC -3'
(R):5'- AGAGGTGGGCGTCATCG -3'

Posted On

2019-11-12