Incidental Mutation 'R7707:Robo4'
ID594352
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7707 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37413122 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 982 (D982V)
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]
Predicted Effect probably benign
Transcript: ENSMUST00000034643
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102895
AA Change: D975V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: D975V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115046
AA Change: D1034V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: D1034V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: D871V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect probably benign
Transcript: ENSMUST00000170512
Predicted Effect probably damaging
Transcript: ENSMUST00000214185
AA Change: D982V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A T 8: 129,219,179 C388* probably null Het
2900026A02Rik T A 5: 113,137,986 M1L probably benign Het
Ap1s3 T C 1: 79,614,247 K129E probably benign Het
Ap3b2 C T 7: 81,476,782 V357I possibly damaging Het
Aplp1 A T 7: 30,443,098 C140S probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asb4 A G 6: 5,430,968 H401R probably benign Het
Bpi A T 2: 158,261,173 E79D probably benign Het
Cant1 C T 11: 118,410,898 V198M possibly damaging Het
Casp9 C T 4: 141,805,467 R225C probably benign Het
Ccdc88b C A 19: 6,857,469 R82L probably benign Het
Chrm4 A G 2: 91,927,354 T36A probably benign Het
Cntln A T 4: 84,884,616 D51V probably damaging Het
Commd8 A T 5: 72,162,738 F120Y probably damaging Het
Cpne6 A C 14: 55,516,314 T410P probably damaging Het
Ctnnb1 A T 9: 120,952,865 I315F possibly damaging Het
Dnah9 A G 11: 66,118,958 V701A probably damaging Het
Efcab9 A G 11: 32,522,851 Y199H possibly damaging Het
Endou T A 15: 97,713,102 probably null Het
Fam160a1 A G 3: 85,676,253 V412A probably benign Het
Foxc2 C T 8: 121,117,902 P430S probably benign Het
Gas2l3 T A 10: 89,414,358 K299N probably damaging Het
Gm10375 G A 14: 43,604,875 Q133* probably null Het
Gorab T C 1: 163,392,440 D211G probably damaging Het
Grin3b T A 10: 79,975,901 S747T possibly damaging Het
Gucd1 C A 10: 75,511,286 probably benign Het
Gucy2d T C 7: 98,451,669 F400L possibly damaging Het
Hivep3 G A 4: 119,733,959 V55M Het
Igsf3 A G 3: 101,459,922 N1157S probably benign Het
Irak3 A T 10: 120,146,584 D324E probably damaging Het
Jup G T 11: 100,383,052 A221D possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr4 A G 2: 109,997,591 probably null Het
Lrrc34 T C 3: 30,624,892 D352G probably benign Het
Metrn C A 17: 25,795,410 A175S probably benign Het
Nr2c1 T A 10: 94,188,165 S411T probably benign Het
Olfr1206 A G 2: 88,864,809 D68G possibly damaging Het
Olfr190 T A 16: 59,074,271 I270F possibly damaging Het
Orc3 T A 4: 34,598,691 K172* probably null Het
Oxnad1 A G 14: 32,102,008 probably null Het
Pcdh7 A G 5: 57,720,330 N409S probably damaging Het
Pcdha11 A T 18: 37,011,792 N312I probably benign Het
Pds5a G T 5: 65,610,133 P121Q unknown Het
Phc1 A G 6: 122,323,780 I380T unknown Het
Phldb3 C A 7: 24,626,597 H535N possibly damaging Het
Proser3 T C 7: 30,539,791 Q600R probably benign Het
Ptprz1 A G 6: 23,002,296 M1462V probably benign Het
Pyroxd2 T C 19: 42,738,147 T243A probably damaging Het
Ralgapa1 C A 12: 55,777,292 D268Y probably null Het
Rapgef5 A C 12: 117,715,344 Y419S probably damaging Het
Rbm24 C A 13: 46,429,129 Q175K possibly damaging Het
Sbf2 T C 7: 110,330,713 probably null Het
Serping1 A T 2: 84,773,699 probably null Het
Shank1 C T 7: 44,344,301 S798F unknown Het
Slc15a5 A T 6: 138,079,747 M57K probably damaging Het
Slc35g1 T A 19: 38,403,123 C284* probably null Het
Src G A 2: 157,464,658 D194N probably damaging Het
Srfbp1 A G 18: 52,483,654 T84A probably damaging Het
Sspo A T 6: 48,461,527 T1510S probably benign Het
Taar1 A T 10: 23,921,237 I278F possibly damaging Het
Taf1a T C 1: 183,404,429 Y281H possibly damaging Het
Thbs3 A T 3: 89,224,900 Y798F possibly damaging Het
Tnpo1 T C 13: 98,890,787 T7A probably benign Het
Traf7 A T 17: 24,510,709 probably null Het
Trbv19 G A 6: 41,178,613 V9I possibly damaging Het
Trim17 C T 11: 58,965,284 Q56* probably null Het
Ttn G T 2: 76,902,062 A4643E unknown Het
Ugt2b36 A G 5: 87,081,508 probably null Het
Uso1 A G 5: 92,201,936 *960W probably null Het
Usp2 G T 9: 44,073,460 probably null Het
Wdr20rt A G 12: 65,226,207 D148G probably damaging Het
Wdr66 A T 5: 123,253,887 E28V probably benign Het
Wif1 T C 10: 121,083,959 F204L probably damaging Het
Wwp1 T C 4: 19,627,645 D750G probably benign Het
Zmynd12 A T 4: 119,444,866 D234V probably damaging Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R8079:Robo4 UTSW 9 37402635 missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37405640 missense probably damaging 0.99
R8280:Robo4 UTSW 9 37404076 missense probably benign 0.00
R8526:Robo4 UTSW 9 37403505 nonsense probably null
R8547:Robo4 UTSW 9 37404378 missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37408281 missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37405834 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAATCAGTCCTAAGCTTTCTGC -3'
(R):5'- AAACCCCAAGCTCCCTTTTGG -3'

Sequencing Primer
(F):5'- CTGCTGTAAATTGGTCCCTAGGAG -3'
(R):5'- TCTCCAGGACTTCTCAATTAAGG -3'
Posted On2019-11-12