Incidental Mutation 'R7707:Taar1'
ID 594354
Institutional Source Beutler Lab
Gene Symbol Taar1
Ensembl Gene ENSMUSG00000056379
Gene Name trace amine-associated receptor 1
Synonyms Trar1, Tar1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7707 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 23920356-23921469 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23921237 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 278 (I278F)
Ref Sequence ENSEMBL: ENSMUSP00000049527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051532]
AlphaFold Q923Y8
Predicted Effect possibly damaging
Transcript: ENSMUST00000051532
AA Change: I278F

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049527
Gene: ENSMUSG00000056379
AA Change: I278F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 316 1.4e-11 PFAM
Pfam:7tm_1 39 301 2.4e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null mutation display decreased prepulse inhibition and increased sensitivity to amphetamines. Mice homozygous for another knock-out allele exhibit increased sensitivity to MDMA-induced hyperthermia, brain dopamine and serotonin levels, and induced hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A T 8: 129,219,179 C388* probably null Het
2900026A02Rik T A 5: 113,137,986 M1L probably benign Het
Ap1s3 T C 1: 79,614,247 K129E probably benign Het
Ap3b2 C T 7: 81,476,782 V357I possibly damaging Het
Aplp1 A T 7: 30,443,098 C140S probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asb4 A G 6: 5,430,968 H401R probably benign Het
Bpi A T 2: 158,261,173 E79D probably benign Het
Cant1 C T 11: 118,410,898 V198M possibly damaging Het
Casp9 C T 4: 141,805,467 R225C probably benign Het
Ccdc88b C A 19: 6,857,469 R82L probably benign Het
Chrm4 A G 2: 91,927,354 T36A probably benign Het
Cntln A T 4: 84,884,616 D51V probably damaging Het
Commd8 A T 5: 72,162,738 F120Y probably damaging Het
Cpne6 A C 14: 55,516,314 T410P probably damaging Het
Ctnnb1 A T 9: 120,952,865 I315F possibly damaging Het
Dnah9 A G 11: 66,118,958 V701A probably damaging Het
Efcab9 A G 11: 32,522,851 Y199H possibly damaging Het
Endou T A 15: 97,713,102 probably null Het
Fam160a1 A G 3: 85,676,253 V412A probably benign Het
Foxc2 C T 8: 121,117,902 P430S probably benign Het
Gas2l3 T A 10: 89,414,358 K299N probably damaging Het
Gm10375 G A 14: 43,604,875 Q133* probably null Het
Gorab T C 1: 163,392,440 D211G probably damaging Het
Grin3b T A 10: 79,975,901 S747T possibly damaging Het
Gucd1 C A 10: 75,511,286 probably benign Het
Gucy2d T C 7: 98,451,669 F400L possibly damaging Het
Hivep3 G A 4: 119,733,959 V55M Het
Igsf3 A G 3: 101,459,922 N1157S probably benign Het
Irak3 A T 10: 120,146,584 D324E probably damaging Het
Jup G T 11: 100,383,052 A221D possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr4 A G 2: 109,997,591 probably null Het
Lrrc34 T C 3: 30,624,892 D352G probably benign Het
Metrn C A 17: 25,795,410 A175S probably benign Het
Nr2c1 T A 10: 94,188,165 S411T probably benign Het
Olfr1206 A G 2: 88,864,809 D68G possibly damaging Het
Olfr190 T A 16: 59,074,271 I270F possibly damaging Het
Orc3 T A 4: 34,598,691 K172* probably null Het
Oxnad1 A G 14: 32,102,008 probably null Het
Pcdh7 A G 5: 57,720,330 N409S probably damaging Het
Pcdha11 A T 18: 37,011,792 N312I probably benign Het
Pds5a G T 5: 65,610,133 P121Q unknown Het
Phc1 A G 6: 122,323,780 I380T unknown Het
Phldb3 C A 7: 24,626,597 H535N possibly damaging Het
Proser3 T C 7: 30,539,791 Q600R probably benign Het
Ptprz1 A G 6: 23,002,296 M1462V probably benign Het
Pyroxd2 T C 19: 42,738,147 T243A probably damaging Het
Ralgapa1 C A 12: 55,777,292 D268Y probably null Het
Rapgef5 A C 12: 117,715,344 Y419S probably damaging Het
Rbm24 C A 13: 46,429,129 Q175K possibly damaging Het
Robo4 A T 9: 37,413,122 D982V probably damaging Het
Sbf2 T C 7: 110,330,713 probably null Het
Serping1 A T 2: 84,773,699 probably null Het
Shank1 C T 7: 44,344,301 S798F unknown Het
Slc15a5 A T 6: 138,079,747 M57K probably damaging Het
Slc35g1 T A 19: 38,403,123 C284* probably null Het
Src G A 2: 157,464,658 D194N probably damaging Het
Srfbp1 A G 18: 52,483,654 T84A probably damaging Het
Sspo A T 6: 48,461,527 T1510S probably benign Het
Taf1a T C 1: 183,404,429 Y281H possibly damaging Het
Thbs3 A T 3: 89,224,900 Y798F possibly damaging Het
Tnpo1 T C 13: 98,890,787 T7A probably benign Het
Traf7 A T 17: 24,510,709 probably null Het
Trbv19 G A 6: 41,178,613 V9I possibly damaging Het
Trim17 C T 11: 58,965,284 Q56* probably null Het
Ttn G T 2: 76,902,062 A4643E unknown Het
Ugt2b36 A G 5: 87,081,508 probably null Het
Uso1 A G 5: 92,201,936 *960W probably null Het
Usp2 G T 9: 44,073,460 probably null Het
Wdr20rt A G 12: 65,226,207 D148G probably damaging Het
Wdr66 A T 5: 123,253,887 E28V probably benign Het
Wif1 T C 10: 121,083,959 F204L probably damaging Het
Wwp1 T C 4: 19,627,645 D750G probably benign Het
Zmynd12 A T 4: 119,444,866 D234V probably damaging Het
Other mutations in Taar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Taar1 APN 10 23920446 missense probably benign 0.00
R0022:Taar1 UTSW 10 23920727 missense probably benign 0.45
R0126:Taar1 UTSW 10 23920547 missense probably benign 0.00
R0442:Taar1 UTSW 10 23920482 missense possibly damaging 0.80
R0720:Taar1 UTSW 10 23921073 missense probably damaging 1.00
R0931:Taar1 UTSW 10 23921283 missense probably damaging 1.00
R1270:Taar1 UTSW 10 23920533 missense probably damaging 1.00
R1834:Taar1 UTSW 10 23921189 missense probably benign 0.04
R2137:Taar1 UTSW 10 23921270 missense probably benign
R3765:Taar1 UTSW 10 23921307 missense probably damaging 1.00
R3873:Taar1 UTSW 10 23920584 missense probably damaging 1.00
R5334:Taar1 UTSW 10 23920545 missense probably damaging 1.00
R5418:Taar1 UTSW 10 23921316 missense possibly damaging 0.91
R5578:Taar1 UTSW 10 23920820 missense possibly damaging 0.71
R7048:Taar1 UTSW 10 23920824 missense probably benign 0.40
R7096:Taar1 UTSW 10 23920911 missense possibly damaging 0.48
R7163:Taar1 UTSW 10 23921020 missense probably benign 0.38
R7854:Taar1 UTSW 10 23920782 missense probably benign 0.00
R8036:Taar1 UTSW 10 23921135 missense probably benign 0.01
R8442:Taar1 UTSW 10 23920624 nonsense probably null
R8855:Taar1 UTSW 10 23921078 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAAGGTCAATCAATCGTACGAATG -3'
(R):5'- TGTGCCTATAGTTGGCTCAC -3'

Sequencing Primer
(F):5'- CAATCGTACGAATGTTCAAGTTGG -3'
(R):5'- GAACAGTCAGTGCTCTTAGTCACTG -3'
Posted On 2019-11-12