Incidental Mutation 'R7708:Olfr596'
ID594400
Institutional Source Beutler Lab
Gene Symbol Olfr596
Ensembl Gene ENSMUSG00000073953
Gene Nameolfactory receptor 596
SynonymsOlfr596-ps1, Gm15117, ENSMUSG00000073953, GA_x6K02T2PBJ9-6019769-6019943
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7708 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103305648-103312782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103310561 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 280 (L280P)
Ref Sequence ENSEMBL: ENSMUSP00000149187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104880] [ENSMUST00000214577]
Predicted Effect probably damaging
Transcript: ENSMUST00000104880
AA Change: L280P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100475
Gene: ENSMUSG00000073953
AA Change: L280P

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 210 5.1e-11 PFAM
Pfam:7tm_1 43 293 1.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214577
AA Change: L280P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,680,519 H342R probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asap1 T C 15: 64,152,872 Y315C probably damaging Het
Atp10b C A 11: 43,202,143 T435K probably damaging Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Bspry G T 4: 62,496,100 C310F probably benign Het
Camk2d A T 3: 126,597,440 M1L probably benign Het
Clock T A 5: 76,266,409 S19C probably benign Het
Cxxc1 G T 18: 74,216,243 probably benign Het
Ercc6l2 T A 13: 63,841,514 C176* probably null Het
Fkbp5 A G 17: 28,438,097 F49L probably benign Het
Gm11639 G C 11: 104,964,571 D3816H unknown Het
Gm15130 T A 2: 111,144,617 D67V Het
Gm8298 A G 3: 59,865,335 S87G probably benign Het
Gpatch2 A G 1: 187,232,766 I297V probably benign Het
Gpr135 T G 12: 72,069,959 I345L probably benign Het
Gpr89 G A 3: 96,880,625 T271I possibly damaging Het
Hip1r T A 5: 123,997,469 S503T possibly damaging Het
Hivep1 T A 13: 42,164,277 C2076* probably null Het
Hoxa2 A G 6: 52,164,562 V28A probably damaging Het
Inf2 T C 12: 112,607,557 V765A unknown Het
Krt83 T C 15: 101,487,932 M261V probably benign Het
Mtmr7 A G 8: 40,590,511 Y166H probably damaging Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Olfr1275 T C 2: 111,231,518 I92V probably damaging Het
Olfr231 A G 1: 174,117,734 M94T probably damaging Het
Olfr285 A T 15: 98,313,148 M134K probably damaging Het
Olfr508 C T 7: 108,630,841 P283L probably damaging Het
Olfr905 A T 9: 38,473,385 T213S probably damaging Het
Orm3 A T 4: 63,357,813 E154V probably damaging Het
Pcdhga2 T A 18: 37,671,443 I780N possibly damaging Het
Phf21a T C 2: 92,327,166 probably null Het
Polh G T 17: 46,172,700 D546E probably benign Het
Ptprr A G 10: 116,162,597 D204G probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rpl7l1 A G 17: 46,779,345 V121A possibly damaging Het
Rreb1 A G 13: 37,929,570 T302A probably benign Het
Scn3a C T 2: 65,483,168 V1134I possibly damaging Het
Slc10a6 C T 5: 103,629,262 probably benign Het
Tmprss11f C T 5: 86,524,169 G388D probably damaging Het
Tnf A C 17: 35,200,158 V232G possibly damaging Het
Trappc13 C T 13: 104,147,337 G302D probably benign Het
Trbj1-7 T G 6: 41,535,683 Y14* probably null Het
Vmn1r217 T C 13: 23,114,099 H211R probably benign Het
Vmn2r69 T A 7: 85,412,547 H73L possibly damaging Het
Zfp827 T C 8: 79,175,962 L835S probably damaging Het
Other mutations in Olfr596
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Olfr596 APN 7 103309807 missense probably benign 0.03
IGL01917:Olfr596 APN 7 103310357 nonsense probably null
G1patch:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R0601:Olfr596 UTSW 7 103310164 missense probably damaging 1.00
R0908:Olfr596 UTSW 7 103310573 missense possibly damaging 0.56
R1762:Olfr596 UTSW 7 103310221 missense probably damaging 1.00
R1772:Olfr596 UTSW 7 103310242 missense possibly damaging 0.94
R1806:Olfr596 UTSW 7 103310225 missense probably damaging 1.00
R2035:Olfr596 UTSW 7 103310256 missense probably damaging 1.00
R2365:Olfr596 UTSW 7 103310173 missense probably benign 0.00
R3827:Olfr596 UTSW 7 103309802 missense probably benign 0.12
R4241:Olfr596 UTSW 7 103310661 makesense probably null
R4619:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R4620:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R6279:Olfr596 UTSW 7 103310429 missense probably benign
R6300:Olfr596 UTSW 7 103310429 missense probably benign
R6505:Olfr596 UTSW 7 103309793 missense probably benign 0.00
R6725:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R7175:Olfr596 UTSW 7 103309847 missense probably benign 0.22
R8855:Olfr596 UTSW 7 103309961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCCTACAGGCTGTTTTCTG -3'
(R):5'- TGATGACTCTGCGGTACTGG -3'

Sequencing Primer
(F):5'- GCCTTCCTTCCAGGGATG -3'
(R):5'- GGATGCCCCCTTGATCTAGTTG -3'
Posted On2019-11-12