Incidental Mutation 'R7708:Olfr905'
ID594405
Institutional Source Beutler Lab
Gene Symbol Olfr905
Ensembl Gene ENSMUSG00000096794
Gene Nameolfactory receptor 905
SynonymsMOR167-1, GA_x6K02T2PVTD-32165709-32166641
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7708 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38471107-38477013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38473385 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 213 (T213S)
Ref Sequence ENSEMBL: ENSMUSP00000150357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051111] [ENSMUST00000214377] [ENSMUST00000216724]
Predicted Effect probably damaging
Transcript: ENSMUST00000051111
AA Change: T213S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057998
Gene: ENSMUSG00000096794
AA Change: T213S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-50 PFAM
Pfam:7tm_1 41 298 4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214377
AA Change: T213S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000216724
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,680,519 H342R probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asap1 T C 15: 64,152,872 Y315C probably damaging Het
Atp10b C A 11: 43,202,143 T435K probably damaging Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Bspry G T 4: 62,496,100 C310F probably benign Het
Camk2d A T 3: 126,597,440 M1L probably benign Het
Clock T A 5: 76,266,409 S19C probably benign Het
Ercc6l2 T A 13: 63,841,514 C176* probably null Het
Fkbp5 A G 17: 28,438,097 F49L probably benign Het
Gm11639 G C 11: 104,964,571 D3816H unknown Het
Gm15130 T A 2: 111,144,617 D67V Het
Gm8298 A G 3: 59,865,335 S87G probably benign Het
Gpr135 T G 12: 72,069,959 I345L probably benign Het
Gpr89 G A 3: 96,880,625 T271I possibly damaging Het
Hip1r T A 5: 123,997,469 S503T possibly damaging Het
Hivep1 T A 13: 42,164,277 C2076* probably null Het
Hoxa2 A G 6: 52,164,562 V28A probably damaging Het
Inf2 T C 12: 112,607,557 V765A unknown Het
Krt83 T C 15: 101,487,932 M261V probably benign Het
Mtmr7 A G 8: 40,590,511 Y166H probably damaging Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Olfr1275 T C 2: 111,231,518 I92V probably damaging Het
Olfr231 A G 1: 174,117,734 M94T probably damaging Het
Olfr285 A T 15: 98,313,148 M134K probably damaging Het
Olfr508 C T 7: 108,630,841 P283L probably damaging Het
Olfr596 T C 7: 103,310,561 L280P probably damaging Het
Orm3 A T 4: 63,357,813 E154V probably damaging Het
Pcdhga2 T A 18: 37,671,443 I780N possibly damaging Het
Phf21a T C 2: 92,327,166 probably null Het
Polh G T 17: 46,172,700 D546E probably benign Het
Ptprr A G 10: 116,162,597 D204G probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rpl7l1 A G 17: 46,779,345 V121A possibly damaging Het
Rreb1 A G 13: 37,929,570 T302A probably benign Het
Scn3a C T 2: 65,483,168 V1134I possibly damaging Het
Slc10a6 C T 5: 103,629,262 probably benign Het
Tmprss11f C T 5: 86,524,169 G388D probably damaging Het
Tnf A C 17: 35,200,158 V232G possibly damaging Het
Trappc13 C T 13: 104,147,337 G302D probably benign Het
Trbj1-7 T G 6: 41,535,683 Y14* probably null Het
Vmn1r217 T C 13: 23,114,099 H211R probably benign Het
Vmn2r69 T A 7: 85,412,547 H73L possibly damaging Het
Zfp827 T C 8: 79,175,962 L835S probably damaging Het
Other mutations in Olfr905
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr905 APN 9 38473042 missense possibly damaging 0.52
IGL03168:Olfr905 APN 9 38473019 missense probably benign
R0003:Olfr905 UTSW 9 38473316 missense probably benign 0.24
R0062:Olfr905 UTSW 9 38473258 missense probably benign 0.03
R0625:Olfr905 UTSW 9 38473208 missense possibly damaging 0.90
R0744:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R0836:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R2085:Olfr905 UTSW 9 38472927 missense probably damaging 1.00
R2898:Olfr905 UTSW 9 38472975 missense probably damaging 0.99
R4462:Olfr905 UTSW 9 38473064 missense probably benign 0.32
R4655:Olfr905 UTSW 9 38472824 missense probably damaging 0.99
R5209:Olfr905 UTSW 9 38473521 missense possibly damaging 0.52
R5759:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
R6453:Olfr905 UTSW 9 38473575 missense probably benign 0.18
R6501:Olfr905 UTSW 9 38473289 missense possibly damaging 0.88
R6934:Olfr905 UTSW 9 38473176 missense probably benign
R6999:Olfr905 UTSW 9 38473239 missense probably damaging 1.00
R7295:Olfr905 UTSW 9 38473443 missense probably benign 0.07
R7677:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
X0053:Olfr905 UTSW 9 38473176 missense probably benign
X0065:Olfr905 UTSW 9 38473006 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATTTTCTGGTGCCATGGCTC -3'
(R):5'- AAGCTGTAGATTAAGGGATTCAGC -3'

Sequencing Primer
(F):5'- TCACACGGGATGCATGCTG -3'
(R):5'- GATAGAGGAGATTTTGCCTTCATTC -3'
Posted On2019-11-12