Incidental Mutation 'R7708:Gpr135'
ID594411
Institutional Source Beutler Lab
Gene Symbol Gpr135
Ensembl Gene ENSMUSG00000043398
Gene NameG protein-coupled receptor 135
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7708 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location72067976-72071125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72069959 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 345 (I345L)
Ref Sequence ENSEMBL: ENSMUSP00000058762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019862] [ENSMUST00000050649]
Predicted Effect probably benign
Transcript: ENSMUST00000019862
SMART Domains Protein: ENSMUSP00000019862
Gene: ENSMUSG00000019718

DomainStartEndE-ValueType
Pfam:Pro_racemase 22 352 8.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050649
AA Change: I345L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000058762
Gene: ENSMUSG00000043398
AA Change: I345L

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 65 88 N/A INTRINSIC
Pfam:7tm_1 89 350 7.5e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,680,519 H342R probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asap1 T C 15: 64,152,872 Y315C probably damaging Het
Atp10b C A 11: 43,202,143 T435K probably damaging Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Bspry G T 4: 62,496,100 C310F probably benign Het
Camk2d A T 3: 126,597,440 M1L probably benign Het
Clock T A 5: 76,266,409 S19C probably benign Het
Cxxc1 G T 18: 74,216,243 probably benign Het
Ercc6l2 T A 13: 63,841,514 C176* probably null Het
Fkbp5 A G 17: 28,438,097 F49L probably benign Het
Gm11639 G C 11: 104,964,571 D3816H unknown Het
Gm15130 T A 2: 111,144,617 D67V Het
Gm8298 A G 3: 59,865,335 S87G probably benign Het
Gpatch2 A G 1: 187,232,766 I297V probably benign Het
Gpr89 G A 3: 96,880,625 T271I possibly damaging Het
Hip1r T A 5: 123,997,469 S503T possibly damaging Het
Hivep1 T A 13: 42,164,277 C2076* probably null Het
Hoxa2 A G 6: 52,164,562 V28A probably damaging Het
Inf2 T C 12: 112,607,557 V765A unknown Het
Krt83 T C 15: 101,487,932 M261V probably benign Het
Mtmr7 A G 8: 40,590,511 Y166H probably damaging Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Olfr1275 T C 2: 111,231,518 I92V probably damaging Het
Olfr231 A G 1: 174,117,734 M94T probably damaging Het
Olfr285 A T 15: 98,313,148 M134K probably damaging Het
Olfr508 C T 7: 108,630,841 P283L probably damaging Het
Olfr596 T C 7: 103,310,561 L280P probably damaging Het
Olfr905 A T 9: 38,473,385 T213S probably damaging Het
Orm3 A T 4: 63,357,813 E154V probably damaging Het
Pcdhga2 T A 18: 37,671,443 I780N possibly damaging Het
Phf21a T C 2: 92,327,166 probably null Het
Polh G T 17: 46,172,700 D546E probably benign Het
Ptprr A G 10: 116,162,597 D204G probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rpl7l1 A G 17: 46,779,345 V121A possibly damaging Het
Rreb1 A G 13: 37,929,570 T302A probably benign Het
Scn3a C T 2: 65,483,168 V1134I possibly damaging Het
Slc10a6 C T 5: 103,629,262 probably benign Het
Tmprss11f C T 5: 86,524,169 G388D probably damaging Het
Tnf A C 17: 35,200,158 V232G possibly damaging Het
Trappc13 C T 13: 104,147,337 G302D probably benign Het
Trbj1-7 T G 6: 41,535,683 Y14* probably null Het
Vmn1r217 T C 13: 23,114,099 H211R probably benign Het
Vmn2r69 T A 7: 85,412,547 H73L possibly damaging Het
Zfp827 T C 8: 79,175,962 L835S probably damaging Het
Other mutations in Gpr135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Gpr135 APN 12 72069668 missense probably benign
IGL02059:Gpr135 APN 12 72070084 missense possibly damaging 0.87
IGL02219:Gpr135 APN 12 72070273 missense probably damaging 1.00
IGL02273:Gpr135 APN 12 72069958 missense probably damaging 0.96
R4688:Gpr135 UTSW 12 72070946 missense probably benign
R4791:Gpr135 UTSW 12 72069868 missense probably benign 0.12
R5001:Gpr135 UTSW 12 72070508 missense probably benign 0.10
R5811:Gpr135 UTSW 12 72069867 missense possibly damaging 0.87
R5857:Gpr135 UTSW 12 72070840 missense probably benign 0.25
R7604:Gpr135 UTSW 12 72069867 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGTTGGAAGAAGGCATCCTG -3'
(R):5'- TACCACATCTGCAAGACCGTG -3'

Sequencing Primer
(F):5'- AAGGCATCCTGCTGCAAG -3'
(R):5'- ATGACCACTTACGCGCG -3'
Posted On2019-11-12