Incidental Mutation 'R7708:Hivep1'
ID594415
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Namehuman immunodeficiency virus type I enhancer binding protein 1
SynonymsCryabp1, alphaA-CRYBP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R7708 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location42052021-42192537 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 42164277 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 2076 (C2076*)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148]
Predicted Effect probably null
Transcript: ENSMUST00000060148
AA Change: C2076*
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: C2076*

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222854
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,680,519 H342R probably damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Asap1 T C 15: 64,152,872 Y315C probably damaging Het
Atp10b C A 11: 43,202,143 T435K probably damaging Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Bspry G T 4: 62,496,100 C310F probably benign Het
Camk2d A T 3: 126,597,440 M1L probably benign Het
Clock T A 5: 76,266,409 S19C probably benign Het
Cxxc1 G T 18: 74,216,243 probably benign Het
Ercc6l2 T A 13: 63,841,514 C176* probably null Het
Fkbp5 A G 17: 28,438,097 F49L probably benign Het
Gm11639 G C 11: 104,964,571 D3816H unknown Het
Gm15130 T A 2: 111,144,617 D67V Het
Gm8298 A G 3: 59,865,335 S87G probably benign Het
Gpatch2 A G 1: 187,232,766 I297V probably benign Het
Gpr135 T G 12: 72,069,959 I345L probably benign Het
Gpr89 G A 3: 96,880,625 T271I possibly damaging Het
Hip1r T A 5: 123,997,469 S503T possibly damaging Het
Hoxa2 A G 6: 52,164,562 V28A probably damaging Het
Inf2 T C 12: 112,607,557 V765A unknown Het
Krt83 T C 15: 101,487,932 M261V probably benign Het
Mtmr7 A G 8: 40,590,511 Y166H probably damaging Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Olfr1275 T C 2: 111,231,518 I92V probably damaging Het
Olfr231 A G 1: 174,117,734 M94T probably damaging Het
Olfr285 A T 15: 98,313,148 M134K probably damaging Het
Olfr508 C T 7: 108,630,841 P283L probably damaging Het
Olfr596 T C 7: 103,310,561 L280P probably damaging Het
Olfr905 A T 9: 38,473,385 T213S probably damaging Het
Orm3 A T 4: 63,357,813 E154V probably damaging Het
Pcdhga2 T A 18: 37,671,443 I780N possibly damaging Het
Phf21a T C 2: 92,327,166 probably null Het
Polh G T 17: 46,172,700 D546E probably benign Het
Ptprr A G 10: 116,162,597 D204G probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rpl7l1 A G 17: 46,779,345 V121A possibly damaging Het
Rreb1 A G 13: 37,929,570 T302A probably benign Het
Scn3a C T 2: 65,483,168 V1134I possibly damaging Het
Slc10a6 C T 5: 103,629,262 probably benign Het
Tmprss11f C T 5: 86,524,169 G388D probably damaging Het
Tnf A C 17: 35,200,158 V232G possibly damaging Het
Trappc13 C T 13: 104,147,337 G302D probably benign Het
Trbj1-7 T G 6: 41,535,683 Y14* probably null Het
Vmn1r217 T C 13: 23,114,099 H211R probably benign Het
Vmn2r69 T A 7: 85,412,547 H73L possibly damaging Het
Zfp827 T C 8: 79,175,962 L835S probably damaging Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42154649 missense probably benign 0.00
IGL00572:Hivep1 APN 13 42158871 missense probably benign 0.00
IGL00820:Hivep1 APN 13 42183818 missense probably benign 0.29
IGL00846:Hivep1 APN 13 42167616 nonsense probably null
IGL01068:Hivep1 APN 13 42159984 missense probably benign 0.00
IGL01431:Hivep1 APN 13 42158017 missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42159279 missense probably benign 0.18
IGL01833:Hivep1 APN 13 42154988 nonsense probably null
IGL02037:Hivep1 APN 13 42156077 missense probably benign 0.00
IGL02375:Hivep1 APN 13 42156449 missense probably benign 0.30
IGL02414:Hivep1 APN 13 42154909 missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42155654 missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42157311 missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42157685 missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42155936 missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42158904 missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42156128 missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42181671 missense
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0078:Hivep1 UTSW 13 42156041 missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42155435 missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42156153 missense probably benign
R0245:Hivep1 UTSW 13 42164290 missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42158379 missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42159756 missense probably benign 0.16
R0655:Hivep1 UTSW 13 42167585 missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42154946 missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42156962 missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42157521 missense probably benign 0.03
R1256:Hivep1 UTSW 13 42181831 missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42158043 missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42157140 missense probably benign 0.03
R1438:Hivep1 UTSW 13 42158120 missense probably benign 0.00
R1672:Hivep1 UTSW 13 42160284 missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42157931 missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42155646 missense probably benign 0.38
R1993:Hivep1 UTSW 13 42157493 missense probably benign 0.00
R2004:Hivep1 UTSW 13 42160149 missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42160124 missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42156318 missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42164393 critical splice donor site probably null
R2085:Hivep1 UTSW 13 42183750 missense probably benign 0.34
R3701:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3702:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3716:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3720:Hivep1 UTSW 13 42158601 missense probably benign 0.01
R3820:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R4379:Hivep1 UTSW 13 42155430 missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42155813 missense probably benign
R4587:Hivep1 UTSW 13 42156228 missense probably benign 0.00
R4604:Hivep1 UTSW 13 42159749 missense probably benign 0.08
R4686:Hivep1 UTSW 13 42155850 missense probably benign 0.00
R4725:Hivep1 UTSW 13 42163411 missense probably benign 0.19
R4924:Hivep1 UTSW 13 42158316 missense probably benign 0.20
R5009:Hivep1 UTSW 13 42158753 missense probably benign 0.06
R5320:Hivep1 UTSW 13 42159639 missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42164395 splice site probably null
R5498:Hivep1 UTSW 13 42123158 critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42158328 missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42156650 missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42160117 missense probably benign
R5635:Hivep1 UTSW 13 42160127 missense probably benign 0.16
R5636:Hivep1 UTSW 13 42163456 missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42156612 missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42157218 missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42160188 missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42184458 missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42158370 missense probably benign 0.01
R6247:Hivep1 UTSW 13 42157490 missense probably benign
R6343:Hivep1 UTSW 13 42159671 nonsense probably null
R6631:Hivep1 UTSW 13 42156480 missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42164284 missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42154727 missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42157081 missense probably benign 0.00
R6800:Hivep1 UTSW 13 42157376 missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42156507 missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42183452 missense probably benign 0.00
R6993:Hivep1 UTSW 13 42158714 missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42157338 missense probably benign 0.26
R7139:Hivep1 UTSW 13 42159954 missense probably benign 0.28
R7186:Hivep1 UTSW 13 42156338 missense probably benign 0.01
R7227:Hivep1 UTSW 13 42156911 missense probably benign 0.02
R7263:Hivep1 UTSW 13 42158192 missense possibly damaging 0.50
R7438:Hivep1 UTSW 13 42154911 missense probably damaging 0.99
R7490:Hivep1 UTSW 13 42157650 missense probably damaging 1.00
R7583:Hivep1 UTSW 13 42164240 missense probably damaging 1.00
R7763:Hivep1 UTSW 13 42159461 missense probably benign 0.12
R7840:Hivep1 UTSW 13 42155352 missense probably benign
R7864:Hivep1 UTSW 13 42158814 missense probably benign 0.02
R7913:Hivep1 UTSW 13 42156366 missense probably benign 0.00
R7923:Hivep1 UTSW 13 42155352 missense probably benign
R7947:Hivep1 UTSW 13 42158814 missense probably benign 0.02
R7994:Hivep1 UTSW 13 42156366 missense probably benign 0.00
R8017:Hivep1 UTSW 13 42167622 missense
R8019:Hivep1 UTSW 13 42167622 missense
X0060:Hivep1 UTSW 13 42154985 missense probably benign 0.07
X0067:Hivep1 UTSW 13 42156717 missense probably damaging 0.98
Z1177:Hivep1 UTSW 13 42159981 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CATGTTGCAGAAACTAGGAATCTTC -3'
(R):5'- CTGGCTCTCCCATTTAAAGGC -3'

Sequencing Primer
(F):5'- GCAGAAACTAGGAATCTTCTCTTTC -3'
(R):5'- TCCCATTTAAAGGCACACAGGAGG -3'
Posted On2019-11-12