Incidental Mutation 'R7709:Abca12'
ID 594428
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene Name ATP-binding cassette, sub-family A member 12
Synonyms 4833417A11Rik, 4832428G11Rik
MMRRC Submission 045768-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 71282249-71454069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71374887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 340 (D340G)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
AlphaFold E9Q876
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: D340G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: D340G

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,201,334 (GRCm39) I443T probably damaging Het
2310002L09Rik A G 4: 73,861,091 (GRCm39) C170R possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,478,237 (GRCm39) probably null Het
A2m A C 6: 121,637,063 (GRCm39) T809P possibly damaging Het
Abcg8 A T 17: 84,999,919 (GRCm39) D191V probably damaging Het
Acan G T 7: 78,739,356 (GRCm39) V255F probably damaging Het
Ace G A 11: 105,879,663 (GRCm39) V1248I probably benign Het
Adgre1 A T 17: 57,709,519 (GRCm39) Q87L unknown Het
Adgrl1 G A 8: 84,665,617 (GRCm39) V1435M probably benign Het
Ano8 T C 8: 71,934,933 (GRCm39) D423G probably damaging Het
Aox3 T C 1: 58,219,810 (GRCm39) Y1137H probably damaging Het
Arl5a T C 2: 52,295,068 (GRCm39) D114G probably benign Het
B3galt9 T G 2: 34,728,437 (GRCm39) C79G probably damaging Het
Baiap2l2 G T 15: 79,143,911 (GRCm39) N394K probably benign Het
Cap1 A T 4: 122,756,467 (GRCm39) C355S probably damaging Het
Ccdc25 A T 14: 66,077,933 (GRCm39) D22V probably damaging Het
Ceacam2 T C 7: 25,238,076 (GRCm39) D116G probably damaging Het
Clec4b2 A G 6: 123,149,974 (GRCm39) probably benign Het
CN725425 C A 15: 91,124,930 (GRCm39) R157S probably benign Het
Coq8b T C 7: 26,949,962 (GRCm39) I347T probably damaging Het
Ctbp2 C A 7: 132,591,789 (GRCm39) V338L probably benign Het
Cyp2d22 A G 15: 82,258,612 (GRCm39) V83A possibly damaging Het
Daam1 G A 12: 72,024,423 (GRCm39) R797H probably benign Het
Dab1 C A 4: 104,577,756 (GRCm39) S275* probably null Het
Dgkz T C 2: 91,767,404 (GRCm39) E863G probably benign Het
Dhx34 G A 7: 15,946,789 (GRCm39) A515V possibly damaging Het
Dnah14 T C 1: 181,530,049 (GRCm39) probably null Het
Dnmt3b C A 2: 153,514,140 (GRCm39) N384K probably benign Het
Dock5 A G 14: 68,033,454 (GRCm39) Y972H probably benign Het
Etv5 A T 16: 22,231,597 (GRCm39) Y138* probably null Het
Fdps A G 3: 89,008,397 (GRCm39) S4P probably damaging Het
Gart A G 16: 91,419,853 (GRCm39) F885L possibly damaging Het
Gm32687 A T 10: 81,715,328 (GRCm39) H240L probably damaging Het
Gm4553 C T 7: 141,719,384 (GRCm39) G15R unknown Het
Gm572 C T 4: 148,753,408 (GRCm39) T351M probably damaging Het
Gpr3 A T 4: 132,937,748 (GRCm39) L308Q probably damaging Het
Gpsm2 A G 3: 108,609,097 (GRCm39) V174A probably benign Het
Gucy1a1 T C 3: 82,002,096 (GRCm39) H661R unknown Het
Heatr4 A T 12: 84,004,499 (GRCm39) M774K probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Ift81 C T 5: 122,747,394 (GRCm39) V91M probably damaging Het
Igsf10 G T 3: 59,238,964 (GRCm39) Q406K probably damaging Het
Il10ra A G 9: 45,171,697 (GRCm39) V257A probably benign Het
Ina A T 19: 47,012,082 (GRCm39) K500I Het
Lce1i A T 3: 92,685,066 (GRCm39) C37S unknown Het
Lrrc59 A T 11: 94,525,811 (GRCm39) D133V probably damaging Het
Magi3 A G 3: 103,941,354 (GRCm39) I867T probably damaging Het
Mmaa T A 8: 79,995,830 (GRCm39) R298W probably damaging Het
Mon1a G T 9: 107,777,327 (GRCm39) V77F probably benign Het
Mrc2 A G 11: 105,237,285 (GRCm39) T1030A probably benign Het
Mrps27 T A 13: 99,541,504 (GRCm39) S162T probably benign Het
Mtmr12 T A 15: 12,245,097 (GRCm39) M204K probably damaging Het
Mtus1 A G 8: 41,507,687 (GRCm39) I21T possibly damaging Het
Myh2 T C 11: 67,085,690 (GRCm39) V1844A probably benign Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Nbr1 T G 11: 101,447,067 (GRCm39) F18V probably damaging Het
Npy2r T C 3: 82,447,689 (GRCm39) N362S probably benign Het
Ocln T A 13: 100,676,106 (GRCm39) Y129F probably damaging Het
Or2t1 T C 14: 14,328,384 (GRCm38) I91T probably damaging Het
Or4c10 T C 2: 89,760,225 (GRCm39) I24T probably benign Het
Or8c20 A G 9: 38,260,573 (GRCm39) M59V probably benign Het
Pik3c2b T G 1: 133,007,579 (GRCm39) probably null Het
Prss39 A G 1: 34,541,709 (GRCm39) D262G probably damaging Het
Ptk7 T A 17: 46,882,569 (GRCm39) D886V possibly damaging Het
Ptprg T A 14: 12,226,452 (GRCm38) D1348E probably damaging Het
Rabgap1 T C 2: 37,427,339 (GRCm39) I640T possibly damaging Het
Rogdi A G 16: 4,827,098 (GRCm39) Y303H probably damaging Het
Rps6kb1 A T 11: 86,404,148 (GRCm39) M283K probably damaging Het
Sardh T A 2: 27,131,529 (GRCm39) T188S possibly damaging Het
Sebox A G 11: 78,394,919 (GRCm39) E87G probably damaging Het
Smchd1 A T 17: 71,665,193 (GRCm39) M1830K probably damaging Het
Spata31h1 A C 10: 82,126,366 (GRCm39) S2215A possibly damaging Het
Spink8 G A 9: 109,645,848 (GRCm39) V7I probably benign Het
Src G A 2: 157,299,164 (GRCm39) V54M probably benign Het
Taar2 A G 10: 23,816,621 (GRCm39) I54V probably benign Het
Tpo A T 12: 30,181,859 (GRCm39) V12E possibly damaging Het
Txk T C 5: 72,864,918 (GRCm39) D373G probably damaging Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Vil1 C T 1: 74,465,754 (GRCm39) T515M probably benign Het
Wdr47 G T 3: 108,525,837 (GRCm39) C120F probably damaging Het
Ylpm1 C T 12: 85,059,799 (GRCm39) P335L unknown Het
Zfp148 T A 16: 33,288,545 (GRCm39) I220N probably damaging Het
Zfp992 A T 4: 146,551,622 (GRCm39) K448* probably null Het
Zfp994 T C 17: 22,419,406 (GRCm39) I514M probably benign Het
Zp2 A T 7: 119,734,998 (GRCm39) I429N probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71,342,700 (GRCm39) missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71,392,916 (GRCm39) missense probably benign 0.00
IGL00813:Abca12 APN 1 71,392,921 (GRCm39) critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71,341,892 (GRCm39) missense probably damaging 1.00
IGL00921:Abca12 APN 1 71,324,888 (GRCm39) missense probably damaging 1.00
IGL01011:Abca12 APN 1 71,302,791 (GRCm39) missense probably benign 0.02
IGL01066:Abca12 APN 1 71,392,889 (GRCm39) missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71,353,273 (GRCm39) missense probably damaging 1.00
IGL01310:Abca12 APN 1 71,323,315 (GRCm39) missense probably benign 0.00
IGL01360:Abca12 APN 1 71,325,648 (GRCm39) missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71,359,045 (GRCm39) missense probably benign 0.00
IGL01608:Abca12 APN 1 71,298,601 (GRCm39) missense probably damaging 1.00
IGL01687:Abca12 APN 1 71,306,769 (GRCm39) splice site probably benign
IGL01700:Abca12 APN 1 71,319,549 (GRCm39) missense probably benign
IGL01723:Abca12 APN 1 71,353,327 (GRCm39) missense probably benign 0.01
IGL01804:Abca12 APN 1 71,315,342 (GRCm39) missense probably benign 0.01
IGL01982:Abca12 APN 1 71,385,857 (GRCm39) missense probably benign 0.34
IGL02136:Abca12 APN 1 71,286,301 (GRCm39) missense probably damaging 1.00
IGL02172:Abca12 APN 1 71,341,817 (GRCm39) missense probably benign 0.09
IGL02222:Abca12 APN 1 71,322,045 (GRCm39) missense probably benign 0.40
IGL02266:Abca12 APN 1 71,307,360 (GRCm39) nonsense probably null
IGL02449:Abca12 APN 1 71,440,908 (GRCm39) splice site probably null
IGL02471:Abca12 APN 1 71,297,357 (GRCm39) missense probably benign 0.00
IGL02496:Abca12 APN 1 71,327,712 (GRCm39) missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71,333,906 (GRCm39) missense probably damaging 0.96
IGL02795:Abca12 APN 1 71,327,907 (GRCm39) missense probably damaging 1.00
IGL03000:Abca12 APN 1 71,360,959 (GRCm39) missense probably benign 0.01
IGL03031:Abca12 APN 1 71,353,183 (GRCm39) missense probably benign 0.00
IGL03131:Abca12 APN 1 71,385,861 (GRCm39) missense probably benign
IGL03260:Abca12 APN 1 71,323,258 (GRCm39) missense probably damaging 1.00
IGL03324:Abca12 APN 1 71,353,167 (GRCm39) missense probably benign
IGL03408:Abca12 APN 1 71,303,954 (GRCm39) missense probably damaging 1.00
R0016:Abca12 UTSW 1 71,333,959 (GRCm39) missense probably benign 0.35
R0016:Abca12 UTSW 1 71,333,959 (GRCm39) missense probably benign 0.35
R0121:Abca12 UTSW 1 71,298,945 (GRCm39) splice site probably null
R0172:Abca12 UTSW 1 71,318,561 (GRCm39) missense probably damaging 0.99
R0196:Abca12 UTSW 1 71,298,972 (GRCm39) missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71,298,935 (GRCm39) splice site probably benign
R0466:Abca12 UTSW 1 71,341,822 (GRCm39) missense probably damaging 1.00
R0616:Abca12 UTSW 1 71,341,830 (GRCm39) missense probably damaging 1.00
R0668:Abca12 UTSW 1 71,302,773 (GRCm39) missense probably damaging 1.00
R0928:Abca12 UTSW 1 71,388,333 (GRCm39) missense probably benign 0.06
R1036:Abca12 UTSW 1 71,302,569 (GRCm39) critical splice donor site probably null
R1086:Abca12 UTSW 1 71,334,220 (GRCm39) splice site probably benign
R1300:Abca12 UTSW 1 71,283,967 (GRCm39) missense probably damaging 1.00
R1337:Abca12 UTSW 1 71,333,978 (GRCm39) missense probably benign 0.03
R1356:Abca12 UTSW 1 71,342,112 (GRCm39) splice site probably benign
R1372:Abca12 UTSW 1 71,334,016 (GRCm39) missense probably damaging 1.00
R1434:Abca12 UTSW 1 71,348,959 (GRCm39) missense probably benign 0.00
R1580:Abca12 UTSW 1 71,305,124 (GRCm39) missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71,302,570 (GRCm39) critical splice donor site probably null
R1773:Abca12 UTSW 1 71,327,755 (GRCm39) missense probably damaging 1.00
R1829:Abca12 UTSW 1 71,334,188 (GRCm39) missense probably benign 0.26
R1922:Abca12 UTSW 1 71,359,083 (GRCm39) missense probably benign 0.10
R1927:Abca12 UTSW 1 71,283,999 (GRCm39) missense probably damaging 1.00
R2115:Abca12 UTSW 1 71,283,930 (GRCm39) missense probably benign 0.01
R2146:Abca12 UTSW 1 71,302,647 (GRCm39) missense probably benign 0.02
R2148:Abca12 UTSW 1 71,302,647 (GRCm39) missense probably benign 0.02
R2149:Abca12 UTSW 1 71,302,647 (GRCm39) missense probably benign 0.02
R2150:Abca12 UTSW 1 71,302,647 (GRCm39) missense probably benign 0.02
R2299:Abca12 UTSW 1 71,297,381 (GRCm39) missense probably damaging 1.00
R2392:Abca12 UTSW 1 71,297,264 (GRCm39) missense probably damaging 1.00
R2571:Abca12 UTSW 1 71,289,044 (GRCm39) missense probably benign 0.00
R3077:Abca12 UTSW 1 71,306,764 (GRCm39) missense probably benign 0.02
R3078:Abca12 UTSW 1 71,306,764 (GRCm39) missense probably benign 0.02
R3705:Abca12 UTSW 1 71,324,864 (GRCm39) missense probably damaging 1.00
R3800:Abca12 UTSW 1 71,305,046 (GRCm39) missense probably damaging 1.00
R3905:Abca12 UTSW 1 71,318,616 (GRCm39) missense probably benign 0.02
R3905:Abca12 UTSW 1 71,307,389 (GRCm39) missense possibly damaging 0.79
R3962:Abca12 UTSW 1 71,313,674 (GRCm39) splice site probably null
R4082:Abca12 UTSW 1 71,306,622 (GRCm39) missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71,359,030 (GRCm39) critical splice donor site probably null
R4214:Abca12 UTSW 1 71,327,856 (GRCm39) missense probably damaging 0.99
R4403:Abca12 UTSW 1 71,306,595 (GRCm39) missense probably damaging 1.00
R4524:Abca12 UTSW 1 71,342,076 (GRCm39) missense probably benign 0.19
R4615:Abca12 UTSW 1 71,369,493 (GRCm39) missense probably benign
R4617:Abca12 UTSW 1 71,369,493 (GRCm39) missense probably benign
R4714:Abca12 UTSW 1 71,360,609 (GRCm39) missense probably benign 0.00
R4809:Abca12 UTSW 1 71,318,015 (GRCm39) missense probably benign 0.10
R4810:Abca12 UTSW 1 71,342,771 (GRCm39) missense probably benign 0.00
R4825:Abca12 UTSW 1 71,341,844 (GRCm39) missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71,334,098 (GRCm39) missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71,303,926 (GRCm39) missense probably damaging 0.99
R5026:Abca12 UTSW 1 71,356,383 (GRCm39) missense probably benign 0.04
R5064:Abca12 UTSW 1 71,340,119 (GRCm39) missense probably damaging 1.00
R5188:Abca12 UTSW 1 71,330,651 (GRCm39) missense probably benign 0.23
R5234:Abca12 UTSW 1 71,302,823 (GRCm39) missense probably damaging 0.99
R5267:Abca12 UTSW 1 71,374,933 (GRCm39) splice site probably benign
R5302:Abca12 UTSW 1 71,323,111 (GRCm39) missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71,334,215 (GRCm39) missense probably damaging 1.00
R5451:Abca12 UTSW 1 71,334,076 (GRCm39) missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71,331,605 (GRCm39) missense probably benign 0.29
R5529:Abca12 UTSW 1 71,304,040 (GRCm39) missense probably damaging 1.00
R5615:Abca12 UTSW 1 71,346,218 (GRCm39) missense probably damaging 1.00
R5649:Abca12 UTSW 1 71,330,501 (GRCm39) missense probably damaging 1.00
R5800:Abca12 UTSW 1 71,360,591 (GRCm39) missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71,342,651 (GRCm39) missense probably damaging 1.00
R5878:Abca12 UTSW 1 71,385,792 (GRCm39) missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71,297,257 (GRCm39) missense probably damaging 1.00
R6280:Abca12 UTSW 1 71,311,619 (GRCm39) missense probably benign 0.04
R6316:Abca12 UTSW 1 71,353,118 (GRCm39) missense probably benign 0.01
R6337:Abca12 UTSW 1 71,334,172 (GRCm39) missense probably damaging 1.00
R6383:Abca12 UTSW 1 71,286,343 (GRCm39) missense probably benign 0.03
R6564:Abca12 UTSW 1 71,349,009 (GRCm39) missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71,297,384 (GRCm39) missense probably benign 0.00
R6756:Abca12 UTSW 1 71,298,512 (GRCm39) splice site probably null
R6876:Abca12 UTSW 1 71,302,667 (GRCm39) missense probably damaging 0.98
R6999:Abca12 UTSW 1 71,356,321 (GRCm39) nonsense probably null
R7145:Abca12 UTSW 1 71,346,212 (GRCm39) missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71,287,591 (GRCm39) missense probably damaging 0.99
R7285:Abca12 UTSW 1 71,388,314 (GRCm39) nonsense probably null
R7421:Abca12 UTSW 1 71,286,295 (GRCm39) nonsense probably null
R7531:Abca12 UTSW 1 71,286,332 (GRCm39) missense probably damaging 0.99
R7592:Abca12 UTSW 1 71,327,836 (GRCm39) missense probably benign 0.01
R7687:Abca12 UTSW 1 71,297,341 (GRCm39) missense probably benign 0.00
R7690:Abca12 UTSW 1 71,353,313 (GRCm39) missense probably benign 0.00
R7736:Abca12 UTSW 1 71,359,123 (GRCm39) missense probably benign 0.01
R7754:Abca12 UTSW 1 71,342,046 (GRCm39) missense probably benign
R7761:Abca12 UTSW 1 71,369,447 (GRCm39) missense probably damaging 1.00
R7808:Abca12 UTSW 1 71,313,793 (GRCm39) splice site probably null
R7816:Abca12 UTSW 1 71,331,588 (GRCm39) missense probably benign 0.01
R7821:Abca12 UTSW 1 71,298,950 (GRCm39) missense probably benign 0.12
R7827:Abca12 UTSW 1 71,453,837 (GRCm39) start gained probably benign
R7829:Abca12 UTSW 1 71,331,580 (GRCm39) missense probably benign 0.37
R7863:Abca12 UTSW 1 71,332,656 (GRCm39) missense probably damaging 0.96
R8053:Abca12 UTSW 1 71,388,328 (GRCm39) nonsense probably null
R8093:Abca12 UTSW 1 71,319,552 (GRCm39) missense probably benign 0.00
R8120:Abca12 UTSW 1 71,298,540 (GRCm39) missense possibly damaging 0.92
R8136:Abca12 UTSW 1 71,287,556 (GRCm39) missense probably benign 0.15
R8155:Abca12 UTSW 1 71,330,497 (GRCm39) missense probably damaging 1.00
R8189:Abca12 UTSW 1 71,324,885 (GRCm39) missense probably damaging 1.00
R8233:Abca12 UTSW 1 71,390,916 (GRCm39) missense probably benign 0.00
R8249:Abca12 UTSW 1 71,360,971 (GRCm39) missense probably benign 0.00
R8255:Abca12 UTSW 1 71,359,058 (GRCm39) missense probably benign 0.13
R8300:Abca12 UTSW 1 71,353,123 (GRCm39) missense possibly damaging 0.77
R8339:Abca12 UTSW 1 71,324,831 (GRCm39) missense probably damaging 1.00
R8490:Abca12 UTSW 1 71,323,256 (GRCm39) missense probably damaging 1.00
R8494:Abca12 UTSW 1 71,327,821 (GRCm39) missense probably benign 0.02
R8527:Abca12 UTSW 1 71,349,047 (GRCm39) critical splice acceptor site probably null
R8542:Abca12 UTSW 1 71,349,047 (GRCm39) critical splice acceptor site probably null
R8692:Abca12 UTSW 1 71,327,874 (GRCm39) missense probably damaging 0.96
R8723:Abca12 UTSW 1 71,360,897 (GRCm39) missense probably benign 0.04
R8796:Abca12 UTSW 1 71,297,248 (GRCm39) critical splice donor site probably benign
R8911:Abca12 UTSW 1 71,380,690 (GRCm39) missense probably benign 0.07
R8913:Abca12 UTSW 1 71,303,972 (GRCm39) missense probably damaging 1.00
R8957:Abca12 UTSW 1 71,360,784 (GRCm39) missense possibly damaging 0.90
R9000:Abca12 UTSW 1 71,353,195 (GRCm39) missense probably damaging 1.00
R9137:Abca12 UTSW 1 71,298,525 (GRCm39) missense possibly damaging 0.80
R9228:Abca12 UTSW 1 71,332,599 (GRCm39) missense probably damaging 1.00
R9237:Abca12 UTSW 1 71,318,557 (GRCm39) missense probably damaging 0.97
R9299:Abca12 UTSW 1 71,359,042 (GRCm39) missense possibly damaging 0.48
R9419:Abca12 UTSW 1 71,342,649 (GRCm39) missense possibly damaging 0.81
R9492:Abca12 UTSW 1 71,297,380 (GRCm39) missense possibly damaging 0.81
R9538:Abca12 UTSW 1 71,380,672 (GRCm39) missense probably benign 0.04
R9585:Abca12 UTSW 1 71,342,745 (GRCm39) missense probably damaging 1.00
R9658:Abca12 UTSW 1 71,325,634 (GRCm39) missense probably damaging 0.97
R9763:Abca12 UTSW 1 71,302,717 (GRCm39) missense possibly damaging 0.84
X0013:Abca12 UTSW 1 71,287,592 (GRCm39) missense probably damaging 0.99
X0018:Abca12 UTSW 1 71,353,669 (GRCm39) missense probably benign
X0063:Abca12 UTSW 1 71,388,223 (GRCm39) missense probably benign 0.15
X0065:Abca12 UTSW 1 71,380,620 (GRCm39) critical splice donor site probably null
Z1176:Abca12 UTSW 1 71,323,229 (GRCm39) missense probably damaging 1.00
Z1177:Abca12 UTSW 1 71,331,690 (GRCm39) missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71,321,970 (GRCm39) missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71,315,241 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATAATATGCCCAAACTCGTTGC -3'
(R):5'- ACCTGTGAAATCGGGCCTTG -3'

Sequencing Primer
(F):5'- CAAACTCGTTGCAACTTTACTACAG -3'
(R):5'- TGGGACAAAATATGGTCTGATATGTG -3'
Posted On 2019-11-12