Mutagenetix > Incidental Mutation

Incidental Mutation 'R0032:Krt73'

59443

Institutional Source

Beutler Lab

Gene Symbol

Krt73

Ensembl Gene

ENSMUSG00000063661

Gene Name

keratin 73

Synonyms

MMRRC Submission

038326-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R0032 (G1) of strain 731

Quality Score

205

Status

Validated

Chromosome

Chromosomal Location

101793308-101802346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101794052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 459 (S459G)

Ref Sequence

ENSEMBL: ENSMUSP00000065349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063292]

AlphaFold

Q6NXH9

Predicted Effect

probably benign
Transcript: ENSMUST00000063292
AA Change: S459G

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000065349
Gene: ENSMUSG00000063661
AA Change: S459G

Domain	Start	End	E-Value	Type
low complexity region	17	57	N/A	INTRINSIC
Pfam:Keratin_2_head	59	127	1.4e-19	PFAM
Filament	130	443	5.39e-159	SMART
low complexity region	450	461	N/A	INTRINSIC
low complexity region	466	481	N/A	INTRINSIC

Meta Mutation Damage Score

0.1118

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss3	T	A	10: 107,123,295	T97S	probably benign	Het
Adcy1	T	C	11: 7,144,729	S552P	possibly damaging	Het
Arrb1	T	C	7: 99,582,265	F9L	probably damaging	Het
Auts2	G	C	5: 131,440,093	D571E	probably damaging	Het
C2cd3	T	A	7: 100,444,445		probably benign	Het
Ccbe1	T	G	18: 66,291,652	T35P	possibly damaging	Het
Cct6b	G	T	11: 82,753,643	T202K	possibly damaging	Het
Cd86	A	T	16: 36,620,873	S77R	probably damaging	Het
Cdk5rap3	A	T	11: 96,908,753	L412Q	possibly damaging	Het
Cdsn	G	A	17: 35,555,555	G327D	probably damaging	Het
Cfap54	C	T	10: 92,932,697	R188H	probably benign	Het
Clca3a2	T	A	3: 144,816,733	I176F	probably benign	Het
Cop1	T	C	1: 159,325,036		probably null	Het
Cpne8	T	A	15: 90,569,568		probably benign	Het
Ctsg	T	A	14: 56,101,739	I21F	probably damaging	Het
Cyp2j9	T	G	4: 96,568,806	N476T	possibly damaging	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Dennd4c	T	C	4: 86,828,150		probably null	Het
Des	A	G	1: 75,362,166	E195G	possibly damaging	Het
Dicer1	A	T	12: 104,704,798	L995*	probably null	Het
Dnah10	A	G	5: 124,800,891	K2623R	possibly damaging	Het
Dnajc21	G	T	15: 10,461,877	T146K	probably benign	Het
Dnmbp	A	C	19: 43,902,719	L203R	probably damaging	Het
Eif4g1	C	T	16: 20,685,898	S829F	probably damaging	Het
Enkur	T	C	2: 21,189,304	I153V	probably benign	Het
Epb41l3	G	T	17: 69,210,384		probably null	Het
Erf	T	C	7: 25,245,075	Y277C	possibly damaging	Het
Fstl5	T	A	3: 76,648,435		probably benign	Het
Fuk	G	A	8: 110,892,103	T341M	possibly damaging	Het
Galnt16	T	C	12: 80,592,469	V419A	probably damaging	Het
Gm10226	A	G	17: 21,692,056	D66G	possibly damaging	Het
Gm15821	T	A	17: 34,212,225		probably benign	Het
Grm3	A	G	5: 9,511,452		probably null	Het
Il11ra1	A	G	4: 41,768,187	E366G	probably damaging	Het
Impdh2	A	G	9: 108,561,661	D71G	probably damaging	Het
Ipo11	A	C	13: 106,834,463		probably benign	Het
Ipo8	A	G	6: 148,810,711	C261R	probably damaging	Het
Iqsec3	T	C	6: 121,473,130	D145G	possibly damaging	Het
Itga11	T	C	9: 62,774,095	F998L	probably benign	Het
Junb	T	C	8: 84,977,786	H215R	probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kcnn3	CGCAGCAGCAGCAGCAGCAGCAG	CGCAGCAGCAGCAGCAGCAG	3: 89,520,665		probably benign	Het
Krt74	T	A	15: 101,761,452		noncoding transcript	Het
Meis3	C	A	7: 16,182,285		probably benign	Het
Mlh3	A	G	12: 85,245,749		probably benign	Het
Mroh2a	GT	GTT	1: 88,256,166		probably null	Het
Naip6	C	T	13: 100,303,237	E341K	probably benign	Het
Nbeal2	G	T	9: 110,637,868		probably benign	Het
Nfx1	T	A	4: 41,015,321	V842E	probably benign	Het
Olfr118	T	A	17: 37,672,487	W155R	probably damaging	Het
Olfr800	T	A	10: 129,660,400	V198D	probably benign	Het
Olfr891	A	G	9: 38,180,608	C72R	probably damaging	Het
Oma1	T	A	4: 103,366,012	S465T	possibly damaging	Het
Opa1	A	T	16: 29,615,069	H574L	probably damaging	Het
Otog	T	A	7: 46,288,213	L1782*	probably null	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Pcsk5	T	C	19: 17,564,815	N804S	possibly damaging	Het
Pde4a	C	A	9: 21,201,432		probably benign	Het
Pilra	T	A	5: 137,831,265	D179V	probably damaging	Het
Piwil1	G	A	5: 128,743,280	S247N	probably benign	Het
Ppp2r1a	G	A	17: 20,945,584		probably benign	Het
Prss58	T	G	6: 40,895,699	T158P	probably benign	Het
Setmar	T	A	6: 108,076,416	C290*	probably null	Het
Slc35e3	T	C	10: 117,744,932	M156V	probably benign	Het
Slc4a5	T	A	6: 83,273,157	I509N	probably damaging	Het
Slit2	G	A	5: 48,256,856	R938Q	probably damaging	Het
Snrpn	A	G	7: 59,985,082	Y168H	probably damaging	Het
Sycn	C	T	7: 28,541,292	A128V	possibly damaging	Het
Synm	C	A	7: 67,733,927	R1329M	possibly damaging	Het
Syt8	T	C	7: 142,439,189	V152A	probably benign	Het
Tcp10a	T	C	17: 7,336,907	M247T	probably benign	Het
Tjp2	A	G	19: 24,108,695	L821S	probably damaging	Het
Tppp2	G	T	14: 51,919,409	R81L	possibly damaging	Het
Trim34b	A	G	7: 104,336,577	D473G	possibly damaging	Het
Trpc3	A	G	3: 36,644,256	I618T	probably damaging	Het
Trpm5	A	T	7: 143,085,241	D264E	probably damaging	Het
Tuba8	A	T	6: 121,225,904	D392V	probably benign	Het
Vmn1r50	C	A	6: 90,107,800	P176T	probably damaging	Het
Vmn1r76	T	C	7: 11,931,267	I7V	probably benign	Het
Vmn2r26	T	A	6: 124,039,899	W441R	possibly damaging	Het
Vmn2r57	T	C	7: 41,399,733		probably null	Het
Zc3h4	T	A	7: 16,434,640	D891E	unknown	Het
Zfp120	A	T	2: 150,117,592	V270E	possibly damaging	Het
Znhit1	G	C	5: 136,985,047	R8G	possibly damaging	Het

Other mutations in Krt73

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01082:Krt73	APN	15	101798937	critical splice acceptor site	probably null
IGL01768:Krt73	APN	15	101798856	missense	probably benign	0.01
IGL01836:Krt73	APN	15	101795896	missense	probably benign	0.38
IGL02058:Krt73	APN	15	101802021	missense	probably benign
IGL02063:Krt73	APN	15	101795769	splice site	probably benign
IGL02076:Krt73	APN	15	101799935	missense	probably damaging	1.00
IGL02878:Krt73	APN	15	101798826	missense	probably damaging	1.00
IGL03127:Krt73	APN	15	101795840	missense	probably benign
R0109:Krt73	UTSW	15	101796395	nonsense	probably null
R0143:Krt73	UTSW	15	101800773	missense	probably damaging	1.00
R0233:Krt73	UTSW	15	101802016	missense	probably benign	0.12
R0233:Krt73	UTSW	15	101802016	missense	probably benign	0.12
R0254:Krt73	UTSW	15	101799889	splice site	probably benign
R0256:Krt73	UTSW	15	101801936	missense	probably damaging	1.00
R0497:Krt73	UTSW	15	101802230	missense	probably damaging	0.99
R1592:Krt73	UTSW	15	101802239	nonsense	probably null
R1681:Krt73	UTSW	15	101802047	missense	possibly damaging	0.70
R1696:Krt73	UTSW	15	101799909	missense	probably damaging	1.00
R1766:Krt73	UTSW	15	101793928	missense	probably damaging	1.00
R2031:Krt73	UTSW	15	101798764	splice site	probably benign
R2171:Krt73	UTSW	15	101800910	missense	possibly damaging	0.88
R4674:Krt73	UTSW	15	101802075	missense	probably benign	0.22
R4777:Krt73	UTSW	15	101794001	missense	probably benign
R4869:Krt73	UTSW	15	101796398	missense	probably damaging	1.00
R4892:Krt73	UTSW	15	101795809	missense	probably damaging	0.99
R5794:Krt73	UTSW	15	101794829	missense	probably benign	0.00
R6807:Krt73	UTSW	15	101796407	missense	probably damaging	1.00
R6885:Krt73	UTSW	15	101796398	missense	probably damaging	1.00
R7489:Krt73	UTSW	15	101793859	missense	probably benign	0.00
R7682:Krt73	UTSW	15	101802045	missense	probably benign	0.08
R9167:Krt73	UTSW	15	101793970	missense	probably benign	0.00
R9795:Krt73	UTSW	15	101802290	missense	probably damaging	1.00
Z1177:Krt73	UTSW	15	101793811	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGAGGGTGAGCCCAAAGCCAAG -3'
(R):5'- TCATCCAAGAAAGAGCAGGTGCCG -3'

Sequencing Primer
(F):5'- TTAAATTCACTTGCACTACCCAG -3'
(R):5'- ACTGGGGAGTCTGTGACATC -3'

Posted On

2013-07-11