Mutagenetix > Incidental Mutation

Incidental Mutation 'R7709:Pik3c2b'

594430

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R7709 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 133079841 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably null
Transcript: ENSMUST00000077730

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,407,685	I443T	probably damaging	Het
2310002L09Rik	A	G	4: 73,942,854	C170R	possibly damaging	Het
4932415D10Rik	A	C	10: 82,290,532	S2215A	possibly damaging	Het
4933415A04Rik	GTGTGTGTGTATGTGTGTGT	GTGTGTGTGT	11: 43,587,410		probably null	Het
A2m	A	C	6: 121,660,104	T809P	possibly damaging	Het
Abca12	T	C	1: 71,335,728	D340G	probably benign	Het
Abcg8	A	T	17: 84,692,491	D191V	probably damaging	Het
Acan	G	T	7: 79,089,608	V255F	probably damaging	Het
Ace	G	A	11: 105,988,837	V1248I	probably benign	Het
Adgre1	A	T	17: 57,402,519	Q87L	unknown	Het
Adgrl1	G	A	8: 83,938,988	V1435M	probably benign	Het
Ano8	T	C	8: 71,482,289	D423G	probably damaging	Het
Aox3	T	C	1: 58,180,651	Y1137H	probably damaging	Het
Arl5a	T	C	2: 52,405,056	D114G	probably benign	Het
Baiap2l2	G	T	15: 79,259,711	N394K	probably benign	Het
Cap1	A	T	4: 122,862,674	C355S	probably damaging	Het
Ccdc25	A	T	14: 65,840,484	D22V	probably damaging	Het
Ceacam2	T	C	7: 25,538,651	D116G	probably damaging	Het
Clec4b2	A	G	6: 123,173,015		probably benign	Het
CN725425	C	A	15: 91,240,727	R157S	probably benign	Het
Coq8b	T	C	7: 27,250,537	I347T	probably damaging	Het
Ctbp2	C	A	7: 132,990,060	V338L	probably benign	Het
Cyp2d22	A	G	15: 82,374,411	V83A	possibly damaging	Het
Daam1	G	A	12: 71,977,649	R797H	probably benign	Het
Dab1	C	A	4: 104,720,559	S275*	probably null	Het
Dgkz	T	C	2: 91,937,059	E863G	probably benign	Het
Dhx34	G	A	7: 16,212,864	A515V	possibly damaging	Het
Dnah14	T	C	1: 181,702,484		probably null	Het
Dnmt3b	C	A	2: 153,672,220	N384K	probably benign	Het
Dock5	A	G	14: 67,796,005	Y972H	probably benign	Het
Etv5	A	T	16: 22,412,847	Y138*	probably null	Het
Fdps	A	G	3: 89,101,090	S4P	probably damaging	Het
Gart	A	G	16: 91,622,965	F885L	possibly damaging	Het
Gm32687	A	T	10: 81,879,494	H240L	probably damaging	Het
Gm34653	T	G	2: 34,838,425	C79G	probably damaging	Het
Gm4553	C	T	7: 142,165,647	G15R	unknown	Het
Gm572	C	T	4: 148,668,951	T351M	probably damaging	Het
Gpr3	A	T	4: 133,210,437	L308Q	probably damaging	Het
Gpsm2	A	G	3: 108,701,781	V174A	probably benign	Het
Gucy1a1	T	C	3: 82,094,789	H661R	unknown	Het
Heatr4	A	T	12: 83,957,725	M774K	probably damaging	Het
Hmgcr	A	G	13: 96,663,097	I163T	possibly damaging	Het
Ift81	C	T	5: 122,609,331	V91M	probably damaging	Het
Igsf10	G	T	3: 59,331,543	Q406K	probably damaging	Het
Il10ra	A	G	9: 45,260,399	V257A	probably benign	Het
Ina	A	T	19: 47,023,643	K500I		Het
Lce1i	A	T	3: 92,777,759	C37S	unknown	Het
Lrrc59	A	T	11: 94,634,985	D133V	probably damaging	Het
Magi3	A	G	3: 104,034,038	I867T	probably damaging	Het
Mmaa	T	A	8: 79,269,201	R298W	probably damaging	Het
Mon1a	G	T	9: 107,900,128	V77F	probably benign	Het
Mrc2	A	G	11: 105,346,459	T1030A	probably benign	Het
Mrps27	T	A	13: 99,404,996	S162T	probably benign	Het
Mtmr12	T	A	15: 12,245,011	M204K	probably damaging	Het
Mtus1	A	G	8: 41,054,650	I21T	possibly damaging	Het
Myh2	T	C	11: 67,194,864	V1844A	probably benign	Het
Myh7	C	G	14: 54,988,801	D461H	probably damaging	Het
Nbr1	T	G	11: 101,556,241	F18V	probably damaging	Het
Npy2r	T	C	3: 82,540,382	N362S	probably benign	Het
Ocln	T	A	13: 100,539,598	Y129F	probably damaging	Het
Olfr1258	T	C	2: 89,929,881	I24T	probably benign	Het
Olfr31	T	C	14: 14,328,384	I91T	probably damaging	Het
Olfr898	A	G	9: 38,349,277	M59V	probably benign	Het
Prss39	A	G	1: 34,502,628	D262G	probably damaging	Het
Ptk7	T	A	17: 46,571,643	D886V	possibly damaging	Het
Ptprg	T	A	14: 12,226,452	D1348E	probably damaging	Het
Rabgap1	T	C	2: 37,537,327	I640T	possibly damaging	Het
Rogdi	A	G	16: 5,009,234	Y303H	probably damaging	Het
Rps6kb1	A	T	11: 86,513,322	M283K	probably damaging	Het
Sardh	T	A	2: 27,241,517	T188S	possibly damaging	Het
Sebox	A	G	11: 78,504,093	E87G	probably damaging	Het
Smchd1	A	T	17: 71,358,198	M1830K	probably damaging	Het
Spink8	G	A	9: 109,816,780	V7I	probably benign	Het
Src	G	A	2: 157,457,244	V54M	probably benign	Het
Taar2	A	G	10: 23,940,723	I54V	probably benign	Het
Tpo	A	T	12: 30,131,860	V12E	possibly damaging	Het
Txk	T	C	5: 72,707,575	D373G	probably damaging	Het
Ubr5	G	A	15: 37,979,832	A2434V	probably null	Het
Vil1	C	T	1: 74,426,595	T515M	probably benign	Het
Wdr47	G	T	3: 108,618,521	C120F	probably damaging	Het
Ylpm1	C	T	12: 85,013,025	P335L	unknown	Het
Zfp148	T	A	16: 33,468,175	I220N	probably damaging	Het
Zfp992	A	T	4: 146,467,165	K448*	probably null	Het
Zfp994	T	C	17: 22,200,425	I514M	probably benign	Het
Zp2	A	T	7: 120,135,775	I429N	probably damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTAGAAGCCTTGACAGCG -3'
(R):5'- AGGTGCTTATCTATCTCCTAGGG -3'

Sequencing Primer
(F):5'- TTGACAGCGGCCATCTTG -3'
(R):5'- CTCTCTCTGAGATGGATACAGAC -3'

Posted On

2019-11-12