Incidental Mutation 'R7709:Pik3c2b'
ID 594430
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms C330011J12Rik, PI3K-C2beta
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R7709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 133045667-133108687 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 133079841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,407,685 I443T probably damaging Het
2310002L09Rik A G 4: 73,942,854 C170R possibly damaging Het
4932415D10Rik A C 10: 82,290,532 S2215A possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,587,410 probably null Het
A2m A C 6: 121,660,104 T809P possibly damaging Het
Abca12 T C 1: 71,335,728 D340G probably benign Het
Abcg8 A T 17: 84,692,491 D191V probably damaging Het
Acan G T 7: 79,089,608 V255F probably damaging Het
Ace G A 11: 105,988,837 V1248I probably benign Het
Adgre1 A T 17: 57,402,519 Q87L unknown Het
Adgrl1 G A 8: 83,938,988 V1435M probably benign Het
Ano8 T C 8: 71,482,289 D423G probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Arl5a T C 2: 52,405,056 D114G probably benign Het
Baiap2l2 G T 15: 79,259,711 N394K probably benign Het
Cap1 A T 4: 122,862,674 C355S probably damaging Het
Ccdc25 A T 14: 65,840,484 D22V probably damaging Het
Ceacam2 T C 7: 25,538,651 D116G probably damaging Het
Clec4b2 A G 6: 123,173,015 probably benign Het
CN725425 C A 15: 91,240,727 R157S probably benign Het
Coq8b T C 7: 27,250,537 I347T probably damaging Het
Ctbp2 C A 7: 132,990,060 V338L probably benign Het
Cyp2d22 A G 15: 82,374,411 V83A possibly damaging Het
Daam1 G A 12: 71,977,649 R797H probably benign Het
Dab1 C A 4: 104,720,559 S275* probably null Het
Dgkz T C 2: 91,937,059 E863G probably benign Het
Dhx34 G A 7: 16,212,864 A515V possibly damaging Het
Dnah14 T C 1: 181,702,484 probably null Het
Dnmt3b C A 2: 153,672,220 N384K probably benign Het
Dock5 A G 14: 67,796,005 Y972H probably benign Het
Etv5 A T 16: 22,412,847 Y138* probably null Het
Fdps A G 3: 89,101,090 S4P probably damaging Het
Gart A G 16: 91,622,965 F885L possibly damaging Het
Gm32687 A T 10: 81,879,494 H240L probably damaging Het
Gm34653 T G 2: 34,838,425 C79G probably damaging Het
Gm4553 C T 7: 142,165,647 G15R unknown Het
Gm572 C T 4: 148,668,951 T351M probably damaging Het
Gpr3 A T 4: 133,210,437 L308Q probably damaging Het
Gpsm2 A G 3: 108,701,781 V174A probably benign Het
Gucy1a1 T C 3: 82,094,789 H661R unknown Het
Heatr4 A T 12: 83,957,725 M774K probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Ift81 C T 5: 122,609,331 V91M probably damaging Het
Igsf10 G T 3: 59,331,543 Q406K probably damaging Het
Il10ra A G 9: 45,260,399 V257A probably benign Het
Ina A T 19: 47,023,643 K500I Het
Lce1i A T 3: 92,777,759 C37S unknown Het
Lrrc59 A T 11: 94,634,985 D133V probably damaging Het
Magi3 A G 3: 104,034,038 I867T probably damaging Het
Mmaa T A 8: 79,269,201 R298W probably damaging Het
Mon1a G T 9: 107,900,128 V77F probably benign Het
Mrc2 A G 11: 105,346,459 T1030A probably benign Het
Mrps27 T A 13: 99,404,996 S162T probably benign Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Mtus1 A G 8: 41,054,650 I21T possibly damaging Het
Myh2 T C 11: 67,194,864 V1844A probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nbr1 T G 11: 101,556,241 F18V probably damaging Het
Npy2r T C 3: 82,540,382 N362S probably benign Het
Ocln T A 13: 100,539,598 Y129F probably damaging Het
Olfr1258 T C 2: 89,929,881 I24T probably benign Het
Olfr31 T C 14: 14,328,384 I91T probably damaging Het
Olfr898 A G 9: 38,349,277 M59V probably benign Het
Prss39 A G 1: 34,502,628 D262G probably damaging Het
Ptk7 T A 17: 46,571,643 D886V possibly damaging Het
Ptprg T A 14: 12,226,452 D1348E probably damaging Het
Rabgap1 T C 2: 37,537,327 I640T possibly damaging Het
Rogdi A G 16: 5,009,234 Y303H probably damaging Het
Rps6kb1 A T 11: 86,513,322 M283K probably damaging Het
Sardh T A 2: 27,241,517 T188S possibly damaging Het
Sebox A G 11: 78,504,093 E87G probably damaging Het
Smchd1 A T 17: 71,358,198 M1830K probably damaging Het
Spink8 G A 9: 109,816,780 V7I probably benign Het
Src G A 2: 157,457,244 V54M probably benign Het
Taar2 A G 10: 23,940,723 I54V probably benign Het
Tpo A T 12: 30,131,860 V12E possibly damaging Het
Txk T C 5: 72,707,575 D373G probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vil1 C T 1: 74,426,595 T515M probably benign Het
Wdr47 G T 3: 108,618,521 C120F probably damaging Het
Ylpm1 C T 12: 85,013,025 P335L unknown Het
Zfp148 T A 16: 33,468,175 I220N probably damaging Het
Zfp992 A T 4: 146,467,165 K448* probably null Het
Zfp994 T C 17: 22,200,425 I514M probably benign Het
Zp2 A T 7: 120,135,775 I429N probably damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133077396 missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133090034 missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133105081 missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133103836 missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 133066711 missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
R7712:Pik3c2b UTSW 1 133085611 missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133102305 missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133100904 missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133103849 missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133075809 critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133090246 missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133088330 missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133090779 missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133077449 missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133084987 critical splice donor site probably null
R9621:Pik3c2b UTSW 1 133071607 missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133094749 missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133090850 missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133091600 missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133066553 missense probably damaging 1.00
Z1176:Pik3c2b UTSW 1 133099686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTAGAAGCCTTGACAGCG -3'
(R):5'- AGGTGCTTATCTATCTCCTAGGG -3'

Sequencing Primer
(F):5'- TTGACAGCGGCCATCTTG -3'
(R):5'- CTCTCTCTGAGATGGATACAGAC -3'
Posted On 2019-11-12