Incidental Mutation 'R7709:Olfr1258'
ID594436
Institutional Source Beutler Lab
Gene Symbol Olfr1258
Ensembl Gene ENSMUSG00000049149
Gene Nameolfactory receptor 1258
SynonymsGA_x6K02T2Q125-51361752-51362687, MOR232-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7709 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89927309-89936334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89929881 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 24 (I24T)
Ref Sequence ENSEMBL: ENSMUSP00000099669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102609] [ENSMUST00000111516] [ENSMUST00000213720]
Predicted Effect probably benign
Transcript: ENSMUST00000102609
AA Change: I24T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099669
Gene: ENSMUSG00000049149
AA Change: I24T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111516
AA Change: I24T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107141
Gene: ENSMUSG00000049149
AA Change: I24T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 4.9e-32 PFAM
Pfam:7tm_4 137 278 2.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213720
AA Change: I24T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,407,685 I443T probably damaging Het
2310002L09Rik A G 4: 73,942,854 C170R possibly damaging Het
4932415D10Rik A C 10: 82,290,532 S2215A possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,587,410 probably null Het
A2m A C 6: 121,660,104 T809P possibly damaging Het
Abca12 T C 1: 71,335,728 D340G probably benign Het
Abcg8 A T 17: 84,692,491 D191V probably damaging Het
Acan G T 7: 79,089,608 V255F probably damaging Het
Ace G A 11: 105,988,837 V1248I probably benign Het
Adgre1 A T 17: 57,402,519 Q87L unknown Het
Adgrl1 G A 8: 83,938,988 V1435M probably benign Het
Ano8 T C 8: 71,482,289 D423G probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Arl5a T C 2: 52,405,056 D114G probably benign Het
Baiap2l2 G T 15: 79,259,711 N394K probably benign Het
Cap1 A T 4: 122,862,674 C355S probably damaging Het
Ccdc25 A T 14: 65,840,484 D22V probably damaging Het
Ceacam2 T C 7: 25,538,651 D116G probably damaging Het
Clec4b2 A G 6: 123,173,015 probably benign Het
CN725425 C A 15: 91,240,727 R157S probably benign Het
Coq8b T C 7: 27,250,537 I347T probably damaging Het
Ctbp2 C A 7: 132,990,060 V338L probably benign Het
Cyp2d22 A G 15: 82,374,411 V83A possibly damaging Het
Daam1 G A 12: 71,977,649 R797H probably benign Het
Dab1 C A 4: 104,720,559 S275* probably null Het
Dgkz T C 2: 91,937,059 E863G probably benign Het
Dhx34 G A 7: 16,212,864 A515V possibly damaging Het
Dnah14 T C 1: 181,702,484 probably null Het
Dnmt3b C A 2: 153,672,220 N384K probably benign Het
Dock5 A G 14: 67,796,005 Y972H probably benign Het
Etv5 A T 16: 22,412,847 Y138* probably null Het
Fdps A G 3: 89,101,090 S4P probably damaging Het
Gart A G 16: 91,622,965 F885L possibly damaging Het
Gm32687 A T 10: 81,879,494 H240L probably damaging Het
Gm34653 T G 2: 34,838,425 C79G probably damaging Het
Gm4553 C T 7: 142,165,647 G15R unknown Het
Gm572 C T 4: 148,668,951 T351M probably damaging Het
Gpr3 A T 4: 133,210,437 L308Q probably damaging Het
Gpsm2 A G 3: 108,701,781 V174A probably benign Het
Gucy1a1 T C 3: 82,094,789 H661R unknown Het
Heatr4 A T 12: 83,957,725 M774K probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Ift81 C T 5: 122,609,331 V91M probably damaging Het
Igsf10 G T 3: 59,331,543 Q406K probably damaging Het
Il10ra A G 9: 45,260,399 V257A probably benign Het
Ina A T 19: 47,023,643 K500I Het
Lce1i A T 3: 92,777,759 C37S unknown Het
Lrrc59 A T 11: 94,634,985 D133V probably damaging Het
Magi3 A G 3: 104,034,038 I867T probably damaging Het
Mmaa T A 8: 79,269,201 R298W probably damaging Het
Mon1a G T 9: 107,900,128 V77F probably benign Het
Mrc2 A G 11: 105,346,459 T1030A probably benign Het
Mrps27 T A 13: 99,404,996 S162T probably benign Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Mtus1 A G 8: 41,054,650 I21T possibly damaging Het
Myh2 T C 11: 67,194,864 V1844A probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nbr1 T G 11: 101,556,241 F18V probably damaging Het
Npy2r T C 3: 82,540,382 N362S probably benign Het
Ocln T A 13: 100,539,598 Y129F probably damaging Het
Olfr31 T C 14: 14,328,384 I91T probably damaging Het
Olfr898 A G 9: 38,349,277 M59V probably benign Het
Pik3c2b T G 1: 133,079,841 probably null Het
Prss39 A G 1: 34,502,628 D262G probably damaging Het
Ptk7 T A 17: 46,571,643 D886V possibly damaging Het
Ptprg T A 14: 12,226,452 D1348E probably damaging Het
Rabgap1 T C 2: 37,537,327 I640T possibly damaging Het
Rogdi A G 16: 5,009,234 Y303H probably damaging Het
Rps6kb1 A T 11: 86,513,322 M283K probably damaging Het
Sardh T A 2: 27,241,517 T188S possibly damaging Het
Sebox A G 11: 78,504,093 E87G probably damaging Het
Smchd1 A T 17: 71,358,198 M1830K probably damaging Het
Spink8 G A 9: 109,816,780 V7I probably benign Het
Src G A 2: 157,457,244 V54M probably benign Het
Taar2 A G 10: 23,940,723 I54V probably benign Het
Tpo A T 12: 30,131,860 V12E possibly damaging Het
Txk T C 5: 72,707,575 D373G probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vil1 C T 1: 74,426,595 T515M probably benign Het
Wdr47 G T 3: 108,618,521 C120F probably damaging Het
Ylpm1 C T 12: 85,013,025 P335L unknown Het
Zfp148 T A 16: 33,468,175 I220N probably damaging Het
Zfp992 A T 4: 146,467,165 K448* probably null Het
Zfp994 T C 17: 22,200,425 I514M probably benign Het
Zp2 A T 7: 120,135,775 I429N probably damaging Het
Other mutations in Olfr1258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1258 APN 2 89930544 missense probably damaging 0.96
IGL02552:Olfr1258 APN 2 89930559 missense probably benign 0.01
IGL03300:Olfr1258 APN 2 89930227 nonsense probably null
R0081:Olfr1258 UTSW 2 89930079 missense possibly damaging 0.90
R0197:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0701:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0883:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R1163:Olfr1258 UTSW 2 89930105 missense possibly damaging 0.78
R1833:Olfr1258 UTSW 2 89930301 nonsense probably null
R1846:Olfr1258 UTSW 2 89930666 missense possibly damaging 0.45
R4504:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4507:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4679:Olfr1258 UTSW 2 89930664 missense possibly damaging 0.63
R4908:Olfr1258 UTSW 2 89930579 missense probably benign 0.00
R5430:Olfr1258 UTSW 2 89929913 missense probably benign 0.00
R6836:Olfr1258 UTSW 2 89930339 missense probably damaging 1.00
R7552:Olfr1258 UTSW 2 89930720 missense probably benign 0.06
R8060:Olfr1258 UTSW 2 89930349 missense probably benign 0.04
R8349:Olfr1258 UTSW 2 89930534 missense possibly damaging 0.48
R8449:Olfr1258 UTSW 2 89930534 missense possibly damaging 0.48
Z1177:Olfr1258 UTSW 2 89930598 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCAAATGGAATTGAAACACTCG -3'
(R):5'- AAGACCTGGGTCATGCATC -3'

Sequencing Primer
(F):5'- AAACACTCGTTTGTTTGCTTGTTTG -3'
(R):5'- CCTGGGTCATGCATCCATTGAATAG -3'
Posted On2019-11-12