Incidental Mutation 'R7709:Magi3'
ID 594445
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission 045768-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R7709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 103920575-104127690 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103941354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 867 (I867T)
Ref Sequence ENSEMBL: ENSMUSP00000067932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: I867T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: I867T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: I867T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: I867T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: I867T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: I867T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,201,334 (GRCm39) I443T probably damaging Het
2310002L09Rik A G 4: 73,861,091 (GRCm39) C170R possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,478,237 (GRCm39) probably null Het
A2m A C 6: 121,637,063 (GRCm39) T809P possibly damaging Het
Abca12 T C 1: 71,374,887 (GRCm39) D340G probably benign Het
Abcg8 A T 17: 84,999,919 (GRCm39) D191V probably damaging Het
Acan G T 7: 78,739,356 (GRCm39) V255F probably damaging Het
Ace G A 11: 105,879,663 (GRCm39) V1248I probably benign Het
Adgre1 A T 17: 57,709,519 (GRCm39) Q87L unknown Het
Adgrl1 G A 8: 84,665,617 (GRCm39) V1435M probably benign Het
Ano8 T C 8: 71,934,933 (GRCm39) D423G probably damaging Het
Aox3 T C 1: 58,219,810 (GRCm39) Y1137H probably damaging Het
Arl5a T C 2: 52,295,068 (GRCm39) D114G probably benign Het
B3galt9 T G 2: 34,728,437 (GRCm39) C79G probably damaging Het
Baiap2l2 G T 15: 79,143,911 (GRCm39) N394K probably benign Het
Cap1 A T 4: 122,756,467 (GRCm39) C355S probably damaging Het
Ccdc25 A T 14: 66,077,933 (GRCm39) D22V probably damaging Het
Ceacam2 T C 7: 25,238,076 (GRCm39) D116G probably damaging Het
Clec4b2 A G 6: 123,149,974 (GRCm39) probably benign Het
CN725425 C A 15: 91,124,930 (GRCm39) R157S probably benign Het
Coq8b T C 7: 26,949,962 (GRCm39) I347T probably damaging Het
Ctbp2 C A 7: 132,591,789 (GRCm39) V338L probably benign Het
Cyp2d22 A G 15: 82,258,612 (GRCm39) V83A possibly damaging Het
Daam1 G A 12: 72,024,423 (GRCm39) R797H probably benign Het
Dab1 C A 4: 104,577,756 (GRCm39) S275* probably null Het
Dgkz T C 2: 91,767,404 (GRCm39) E863G probably benign Het
Dhx34 G A 7: 15,946,789 (GRCm39) A515V possibly damaging Het
Dnah14 T C 1: 181,530,049 (GRCm39) probably null Het
Dnmt3b C A 2: 153,514,140 (GRCm39) N384K probably benign Het
Dock5 A G 14: 68,033,454 (GRCm39) Y972H probably benign Het
Etv5 A T 16: 22,231,597 (GRCm39) Y138* probably null Het
Fdps A G 3: 89,008,397 (GRCm39) S4P probably damaging Het
Gart A G 16: 91,419,853 (GRCm39) F885L possibly damaging Het
Gm32687 A T 10: 81,715,328 (GRCm39) H240L probably damaging Het
Gm4553 C T 7: 141,719,384 (GRCm39) G15R unknown Het
Gm572 C T 4: 148,753,408 (GRCm39) T351M probably damaging Het
Gpr3 A T 4: 132,937,748 (GRCm39) L308Q probably damaging Het
Gpsm2 A G 3: 108,609,097 (GRCm39) V174A probably benign Het
Gucy1a1 T C 3: 82,002,096 (GRCm39) H661R unknown Het
Heatr4 A T 12: 84,004,499 (GRCm39) M774K probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Ift81 C T 5: 122,747,394 (GRCm39) V91M probably damaging Het
Igsf10 G T 3: 59,238,964 (GRCm39) Q406K probably damaging Het
Il10ra A G 9: 45,171,697 (GRCm39) V257A probably benign Het
Ina A T 19: 47,012,082 (GRCm39) K500I Het
Lce1i A T 3: 92,685,066 (GRCm39) C37S unknown Het
Lrrc59 A T 11: 94,525,811 (GRCm39) D133V probably damaging Het
Mmaa T A 8: 79,995,830 (GRCm39) R298W probably damaging Het
Mon1a G T 9: 107,777,327 (GRCm39) V77F probably benign Het
Mrc2 A G 11: 105,237,285 (GRCm39) T1030A probably benign Het
Mrps27 T A 13: 99,541,504 (GRCm39) S162T probably benign Het
Mtmr12 T A 15: 12,245,097 (GRCm39) M204K probably damaging Het
Mtus1 A G 8: 41,507,687 (GRCm39) I21T possibly damaging Het
Myh2 T C 11: 67,085,690 (GRCm39) V1844A probably benign Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Nbr1 T G 11: 101,447,067 (GRCm39) F18V probably damaging Het
Npy2r T C 3: 82,447,689 (GRCm39) N362S probably benign Het
Ocln T A 13: 100,676,106 (GRCm39) Y129F probably damaging Het
Or2t1 T C 14: 14,328,384 (GRCm38) I91T probably damaging Het
Or4c10 T C 2: 89,760,225 (GRCm39) I24T probably benign Het
Or8c20 A G 9: 38,260,573 (GRCm39) M59V probably benign Het
Pik3c2b T G 1: 133,007,579 (GRCm39) probably null Het
Prss39 A G 1: 34,541,709 (GRCm39) D262G probably damaging Het
Ptk7 T A 17: 46,882,569 (GRCm39) D886V possibly damaging Het
Ptprg T A 14: 12,226,452 (GRCm38) D1348E probably damaging Het
Rabgap1 T C 2: 37,427,339 (GRCm39) I640T possibly damaging Het
Rogdi A G 16: 4,827,098 (GRCm39) Y303H probably damaging Het
Rps6kb1 A T 11: 86,404,148 (GRCm39) M283K probably damaging Het
Sardh T A 2: 27,131,529 (GRCm39) T188S possibly damaging Het
Sebox A G 11: 78,394,919 (GRCm39) E87G probably damaging Het
Smchd1 A T 17: 71,665,193 (GRCm39) M1830K probably damaging Het
Spata31h1 A C 10: 82,126,366 (GRCm39) S2215A possibly damaging Het
Spink8 G A 9: 109,645,848 (GRCm39) V7I probably benign Het
Src G A 2: 157,299,164 (GRCm39) V54M probably benign Het
Taar2 A G 10: 23,816,621 (GRCm39) I54V probably benign Het
Tpo A T 12: 30,181,859 (GRCm39) V12E possibly damaging Het
Txk T C 5: 72,864,918 (GRCm39) D373G probably damaging Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Vil1 C T 1: 74,465,754 (GRCm39) T515M probably benign Het
Wdr47 G T 3: 108,525,837 (GRCm39) C120F probably damaging Het
Ylpm1 C T 12: 85,059,799 (GRCm39) P335L unknown Het
Zfp148 T A 16: 33,288,545 (GRCm39) I220N probably damaging Het
Zfp992 A T 4: 146,551,622 (GRCm39) K448* probably null Het
Zfp994 T C 17: 22,419,406 (GRCm39) I514M probably benign Het
Zp2 A T 7: 119,734,998 (GRCm39) I429N probably damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 103,922,294 (GRCm39) missense probably damaging 1.00
IGL00933:Magi3 APN 3 103,923,163 (GRCm39) missense probably benign
IGL01151:Magi3 APN 3 103,958,690 (GRCm39) missense probably damaging 1.00
IGL01674:Magi3 APN 3 104,013,037 (GRCm39) splice site probably benign
IGL01790:Magi3 APN 3 103,992,560 (GRCm39) missense probably damaging 1.00
IGL01903:Magi3 APN 3 103,958,526 (GRCm39) missense possibly damaging 0.87
IGL01939:Magi3 APN 3 103,961,778 (GRCm39) missense probably damaging 0.99
IGL02142:Magi3 APN 3 103,923,219 (GRCm39) missense probably benign 0.32
IGL02183:Magi3 APN 3 103,992,663 (GRCm39) missense probably benign 0.01
IGL02887:Magi3 APN 3 104,002,473 (GRCm39) missense probably damaging 1.00
IGL03071:Magi3 APN 3 103,923,202 (GRCm39) missense possibly damaging 0.51
IGL03085:Magi3 APN 3 103,922,655 (GRCm39) missense possibly damaging 0.88
IGL03192:Magi3 APN 3 103,950,562 (GRCm39) missense probably damaging 1.00
IGL03204:Magi3 APN 3 104,013,151 (GRCm39) missense probably damaging 1.00
IGL03227:Magi3 APN 3 103,958,435 (GRCm39) missense probably benign
IGL03388:Magi3 APN 3 103,923,157 (GRCm39) missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 103,961,668 (GRCm39) missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 103,922,842 (GRCm39) missense probably benign 0.05
R0092:Magi3 UTSW 3 103,958,280 (GRCm39) nonsense probably null
R0514:Magi3 UTSW 3 103,922,338 (GRCm39) missense probably damaging 1.00
R0569:Magi3 UTSW 3 103,923,358 (GRCm39) missense probably benign 0.43
R0608:Magi3 UTSW 3 103,924,873 (GRCm39) missense probably damaging 1.00
R0920:Magi3 UTSW 3 103,941,507 (GRCm39) splice site probably null
R1173:Magi3 UTSW 3 103,968,946 (GRCm39) critical splice donor site probably null
R1256:Magi3 UTSW 3 103,935,126 (GRCm39) missense probably benign 0.08
R1391:Magi3 UTSW 3 103,922,374 (GRCm39) nonsense probably null
R1559:Magi3 UTSW 3 103,954,169 (GRCm39) splice site probably benign
R1568:Magi3 UTSW 3 103,996,843 (GRCm39) missense probably benign 0.02
R1631:Magi3 UTSW 3 103,958,493 (GRCm39) missense probably benign 0.05
R1747:Magi3 UTSW 3 103,941,489 (GRCm39) missense possibly damaging 0.82
R1930:Magi3 UTSW 3 103,996,920 (GRCm39) missense probably damaging 1.00
R1964:Magi3 UTSW 3 103,927,718 (GRCm39) missense probably damaging 0.99
R2151:Magi3 UTSW 3 103,992,554 (GRCm39) missense probably damaging 1.00
R2151:Magi3 UTSW 3 103,954,198 (GRCm39) missense probably damaging 1.00
R2266:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2267:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2268:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2519:Magi3 UTSW 3 103,923,081 (GRCm39) missense probably benign 0.00
R3104:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3105:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3619:Magi3 UTSW 3 103,961,721 (GRCm39) missense probably damaging 1.00
R4158:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4160:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4284:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4285:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4397:Magi3 UTSW 3 104,127,030 (GRCm39) missense probably damaging 1.00
R4512:Magi3 UTSW 3 103,996,871 (GRCm39) missense probably damaging 0.99
R4676:Magi3 UTSW 3 103,923,141 (GRCm39) missense probably benign
R4758:Magi3 UTSW 3 103,922,637 (GRCm39) missense probably benign 0.01
R4940:Magi3 UTSW 3 103,958,708 (GRCm39) missense probably damaging 1.00
R5039:Magi3 UTSW 3 104,013,107 (GRCm39) missense probably damaging 1.00
R5160:Magi3 UTSW 3 103,935,224 (GRCm39) missense possibly damaging 0.46
R5422:Magi3 UTSW 3 103,958,684 (GRCm39) missense probably damaging 1.00
R5509:Magi3 UTSW 3 103,922,818 (GRCm39) missense probably benign 0.00
R5839:Magi3 UTSW 3 104,127,047 (GRCm39) missense probably damaging 1.00
R5924:Magi3 UTSW 3 103,961,854 (GRCm39) splice site probably null
R6018:Magi3 UTSW 3 104,013,128 (GRCm39) missense probably damaging 1.00
R6189:Magi3 UTSW 3 103,958,181 (GRCm39) missense probably damaging 1.00
R6235:Magi3 UTSW 3 103,923,384 (GRCm39) missense probably damaging 0.99
R6244:Magi3 UTSW 3 103,923,013 (GRCm39) missense probably benign 0.16
R6258:Magi3 UTSW 3 103,996,912 (GRCm39) missense probably damaging 1.00
R6358:Magi3 UTSW 3 103,958,268 (GRCm39) missense probably damaging 1.00
R6534:Magi3 UTSW 3 103,992,536 (GRCm39) missense possibly damaging 0.75
R6806:Magi3 UTSW 3 103,954,285 (GRCm39) missense possibly damaging 0.94
R6816:Magi3 UTSW 3 103,997,227 (GRCm39) splice site probably null
R6897:Magi3 UTSW 3 103,996,873 (GRCm39) missense probably damaging 1.00
R7011:Magi3 UTSW 3 104,013,070 (GRCm39) missense probably damaging 1.00
R7039:Magi3 UTSW 3 103,958,699 (GRCm39) missense probably damaging 1.00
R7196:Magi3 UTSW 3 103,956,484 (GRCm39) missense probably benign 0.01
R7237:Magi3 UTSW 3 103,935,227 (GRCm39) missense probably damaging 1.00
R7285:Magi3 UTSW 3 103,941,430 (GRCm39) missense probably benign 0.00
R7724:Magi3 UTSW 3 103,923,243 (GRCm39) missense probably benign 0.04
R7797:Magi3 UTSW 3 103,958,618 (GRCm39) missense probably damaging 1.00
R7950:Magi3 UTSW 3 103,924,005 (GRCm39) missense probably damaging 1.00
R8140:Magi3 UTSW 3 103,941,402 (GRCm39) missense probably damaging 1.00
R8204:Magi3 UTSW 3 103,958,502 (GRCm39) missense probably benign
R8229:Magi3 UTSW 3 103,923,018 (GRCm39) missense probably benign 0.00
R8229:Magi3 UTSW 3 103,923,017 (GRCm39) missense possibly damaging 0.79
R8260:Magi3 UTSW 3 103,922,625 (GRCm39) missense probably benign 0.01
R8348:Magi3 UTSW 3 103,958,531 (GRCm39) missense probably damaging 1.00
R8368:Magi3 UTSW 3 104,002,379 (GRCm39) critical splice donor site probably null
R8543:Magi3 UTSW 3 104,126,984 (GRCm39) missense probably damaging 0.98
R8762:Magi3 UTSW 3 103,958,169 (GRCm39) missense probably damaging 1.00
R8826:Magi3 UTSW 3 103,992,662 (GRCm39) missense probably benign 0.00
R8847:Magi3 UTSW 3 103,922,334 (GRCm39) missense probably benign 0.09
R8892:Magi3 UTSW 3 103,958,141 (GRCm39) missense probably damaging 1.00
R8939:Magi3 UTSW 3 103,996,748 (GRCm39) intron probably benign
R9090:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9187:Magi3 UTSW 3 103,923,073 (GRCm39) missense possibly damaging 0.76
R9271:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9433:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9439:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9557:Magi3 UTSW 3 103,924,933 (GRCm39) missense probably damaging 1.00
R9557:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9697:Magi3 UTSW 3 103,956,458 (GRCm39) critical splice donor site probably null
R9796:Magi3 UTSW 3 103,928,291 (GRCm39) missense probably benign
X0026:Magi3 UTSW 3 103,927,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTGAAAGGTTTAGATTGTC -3'
(R):5'- GGGGCAGCATGCTACATTTC -3'

Sequencing Primer
(F):5'- CAGAAAACCGGGTGTTC -3'
(R):5'- GGGGCAGCATGCTACATTTCTATTC -3'
Posted On 2019-11-12