Incidental Mutation 'R7709:2310002L09Rik'
ID 594449
Institutional Source Beutler Lab
Gene Symbol 2310002L09Rik
Ensembl Gene ENSMUSG00000028396
Gene Name RIKEN cDNA 2310002L09 gene
Synonyms
MMRRC Submission 045768-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 73857608-73869083 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73861091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 170 (C170R)
Ref Sequence ENSEMBL: ENSMUSP00000092633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030101] [ENSMUST00000095023]
AlphaFold Q9D7L5
Predicted Effect possibly damaging
Transcript: ENSMUST00000030101
AA Change: C170R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030101
Gene: ENSMUSG00000028396
AA Change: C170R

DomainStartEndE-ValueType
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095023
AA Change: C170R

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092633
Gene: ENSMUSG00000028396
AA Change: C170R

DomainStartEndE-ValueType
transmembrane domain 174 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,201,334 (GRCm39) I443T probably damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,478,237 (GRCm39) probably null Het
A2m A C 6: 121,637,063 (GRCm39) T809P possibly damaging Het
Abca12 T C 1: 71,374,887 (GRCm39) D340G probably benign Het
Abcg8 A T 17: 84,999,919 (GRCm39) D191V probably damaging Het
Acan G T 7: 78,739,356 (GRCm39) V255F probably damaging Het
Ace G A 11: 105,879,663 (GRCm39) V1248I probably benign Het
Adgre1 A T 17: 57,709,519 (GRCm39) Q87L unknown Het
Adgrl1 G A 8: 84,665,617 (GRCm39) V1435M probably benign Het
Ano8 T C 8: 71,934,933 (GRCm39) D423G probably damaging Het
Aox3 T C 1: 58,219,810 (GRCm39) Y1137H probably damaging Het
Arl5a T C 2: 52,295,068 (GRCm39) D114G probably benign Het
B3galt9 T G 2: 34,728,437 (GRCm39) C79G probably damaging Het
Baiap2l2 G T 15: 79,143,911 (GRCm39) N394K probably benign Het
Cap1 A T 4: 122,756,467 (GRCm39) C355S probably damaging Het
Ccdc25 A T 14: 66,077,933 (GRCm39) D22V probably damaging Het
Ceacam2 T C 7: 25,238,076 (GRCm39) D116G probably damaging Het
Clec4b2 A G 6: 123,149,974 (GRCm39) probably benign Het
CN725425 C A 15: 91,124,930 (GRCm39) R157S probably benign Het
Coq8b T C 7: 26,949,962 (GRCm39) I347T probably damaging Het
Ctbp2 C A 7: 132,591,789 (GRCm39) V338L probably benign Het
Cyp2d22 A G 15: 82,258,612 (GRCm39) V83A possibly damaging Het
Daam1 G A 12: 72,024,423 (GRCm39) R797H probably benign Het
Dab1 C A 4: 104,577,756 (GRCm39) S275* probably null Het
Dgkz T C 2: 91,767,404 (GRCm39) E863G probably benign Het
Dhx34 G A 7: 15,946,789 (GRCm39) A515V possibly damaging Het
Dnah14 T C 1: 181,530,049 (GRCm39) probably null Het
Dnmt3b C A 2: 153,514,140 (GRCm39) N384K probably benign Het
Dock5 A G 14: 68,033,454 (GRCm39) Y972H probably benign Het
Etv5 A T 16: 22,231,597 (GRCm39) Y138* probably null Het
Fdps A G 3: 89,008,397 (GRCm39) S4P probably damaging Het
Gart A G 16: 91,419,853 (GRCm39) F885L possibly damaging Het
Gm32687 A T 10: 81,715,328 (GRCm39) H240L probably damaging Het
Gm4553 C T 7: 141,719,384 (GRCm39) G15R unknown Het
Gm572 C T 4: 148,753,408 (GRCm39) T351M probably damaging Het
Gpr3 A T 4: 132,937,748 (GRCm39) L308Q probably damaging Het
Gpsm2 A G 3: 108,609,097 (GRCm39) V174A probably benign Het
Gucy1a1 T C 3: 82,002,096 (GRCm39) H661R unknown Het
Heatr4 A T 12: 84,004,499 (GRCm39) M774K probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Ift81 C T 5: 122,747,394 (GRCm39) V91M probably damaging Het
Igsf10 G T 3: 59,238,964 (GRCm39) Q406K probably damaging Het
Il10ra A G 9: 45,171,697 (GRCm39) V257A probably benign Het
Ina A T 19: 47,012,082 (GRCm39) K500I Het
Lce1i A T 3: 92,685,066 (GRCm39) C37S unknown Het
Lrrc59 A T 11: 94,525,811 (GRCm39) D133V probably damaging Het
Magi3 A G 3: 103,941,354 (GRCm39) I867T probably damaging Het
Mmaa T A 8: 79,995,830 (GRCm39) R298W probably damaging Het
Mon1a G T 9: 107,777,327 (GRCm39) V77F probably benign Het
Mrc2 A G 11: 105,237,285 (GRCm39) T1030A probably benign Het
Mrps27 T A 13: 99,541,504 (GRCm39) S162T probably benign Het
Mtmr12 T A 15: 12,245,097 (GRCm39) M204K probably damaging Het
Mtus1 A G 8: 41,507,687 (GRCm39) I21T possibly damaging Het
Myh2 T C 11: 67,085,690 (GRCm39) V1844A probably benign Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Nbr1 T G 11: 101,447,067 (GRCm39) F18V probably damaging Het
Npy2r T C 3: 82,447,689 (GRCm39) N362S probably benign Het
Ocln T A 13: 100,676,106 (GRCm39) Y129F probably damaging Het
Or2t1 T C 14: 14,328,384 (GRCm38) I91T probably damaging Het
Or4c10 T C 2: 89,760,225 (GRCm39) I24T probably benign Het
Or8c20 A G 9: 38,260,573 (GRCm39) M59V probably benign Het
Pik3c2b T G 1: 133,007,579 (GRCm39) probably null Het
Prss39 A G 1: 34,541,709 (GRCm39) D262G probably damaging Het
Ptk7 T A 17: 46,882,569 (GRCm39) D886V possibly damaging Het
Ptprg T A 14: 12,226,452 (GRCm38) D1348E probably damaging Het
Rabgap1 T C 2: 37,427,339 (GRCm39) I640T possibly damaging Het
Rogdi A G 16: 4,827,098 (GRCm39) Y303H probably damaging Het
Rps6kb1 A T 11: 86,404,148 (GRCm39) M283K probably damaging Het
Sardh T A 2: 27,131,529 (GRCm39) T188S possibly damaging Het
Sebox A G 11: 78,394,919 (GRCm39) E87G probably damaging Het
Smchd1 A T 17: 71,665,193 (GRCm39) M1830K probably damaging Het
Spata31h1 A C 10: 82,126,366 (GRCm39) S2215A possibly damaging Het
Spink8 G A 9: 109,645,848 (GRCm39) V7I probably benign Het
Src G A 2: 157,299,164 (GRCm39) V54M probably benign Het
Taar2 A G 10: 23,816,621 (GRCm39) I54V probably benign Het
Tpo A T 12: 30,181,859 (GRCm39) V12E possibly damaging Het
Txk T C 5: 72,864,918 (GRCm39) D373G probably damaging Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Vil1 C T 1: 74,465,754 (GRCm39) T515M probably benign Het
Wdr47 G T 3: 108,525,837 (GRCm39) C120F probably damaging Het
Ylpm1 C T 12: 85,059,799 (GRCm39) P335L unknown Het
Zfp148 T A 16: 33,288,545 (GRCm39) I220N probably damaging Het
Zfp992 A T 4: 146,551,622 (GRCm39) K448* probably null Het
Zfp994 T C 17: 22,419,406 (GRCm39) I514M probably benign Het
Zp2 A T 7: 119,734,998 (GRCm39) I429N probably damaging Het
Other mutations in 2310002L09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:2310002L09Rik APN 4 73,860,956 (GRCm39) missense possibly damaging 0.66
IGL01366:2310002L09Rik APN 4 73,868,937 (GRCm39) utr 5 prime probably benign
IGL02596:2310002L09Rik APN 4 73,868,904 (GRCm39) missense possibly damaging 0.94
R0841:2310002L09Rik UTSW 4 73,860,986 (GRCm39) missense probably benign
R2919:2310002L09Rik UTSW 4 73,868,845 (GRCm39) missense probably damaging 1.00
R6056:2310002L09Rik UTSW 4 73,861,115 (GRCm39) missense probably benign 0.00
R6795:2310002L09Rik UTSW 4 73,869,065 (GRCm39) start gained probably benign
R6889:2310002L09Rik UTSW 4 73,861,290 (GRCm39) missense probably benign 0.19
R7793:2310002L09Rik UTSW 4 73,861,172 (GRCm39) missense probably benign 0.05
R8517:2310002L09Rik UTSW 4 73,861,206 (GRCm39) missense probably damaging 1.00
R8671:2310002L09Rik UTSW 4 73,861,166 (GRCm39) missense probably damaging 1.00
R8867:2310002L09Rik UTSW 4 73,861,087 (GRCm39) missense probably damaging 1.00
R8938:2310002L09Rik UTSW 4 73,861,424 (GRCm39) missense probably damaging 1.00
R9618:2310002L09Rik UTSW 4 73,868,934 (GRCm39) start codon destroyed probably null 0.46
Predicted Primers PCR Primer
(F):5'- ATGTTGACCTTCCCAGTCAC -3'
(R):5'- CTAGCGTATAACACCAGCGC -3'

Sequencing Primer
(F):5'- GTTGACCTTCCCAGTCACCTACTC -3'
(R):5'- TCCCTACCCAAGTGGATGATGATG -3'
Posted On 2019-11-12