Incidental Mutation 'R7709:Myh2'
ID594478
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R7709 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67194864 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1844 (V1844A)
Ref Sequence ENSEMBL: ENSMUSP00000018641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably benign
Transcript: ENSMUST00000018641
AA Change: V1844A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: V1844A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170159
AA Change: V1844A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: V1844A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,407,685 I443T probably damaging Het
2310002L09Rik A G 4: 73,942,854 C170R possibly damaging Het
4932415D10Rik A C 10: 82,290,532 S2215A possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,587,410 probably null Het
A2m A C 6: 121,660,104 T809P possibly damaging Het
Abca12 T C 1: 71,335,728 D340G probably benign Het
Abcg8 A T 17: 84,692,491 D191V probably damaging Het
Acan G T 7: 79,089,608 V255F probably damaging Het
Ace G A 11: 105,988,837 V1248I probably benign Het
Adgre1 A T 17: 57,402,519 Q87L unknown Het
Adgrl1 G A 8: 83,938,988 V1435M probably benign Het
Ano8 T C 8: 71,482,289 D423G probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Arl5a T C 2: 52,405,056 D114G probably benign Het
Baiap2l2 G T 15: 79,259,711 N394K probably benign Het
Cap1 A T 4: 122,862,674 C355S probably damaging Het
Ccdc25 A T 14: 65,840,484 D22V probably damaging Het
Ceacam2 T C 7: 25,538,651 D116G probably damaging Het
Clec4b2 A G 6: 123,173,015 probably benign Het
CN725425 C A 15: 91,240,727 R157S probably benign Het
Coq8b T C 7: 27,250,537 I347T probably damaging Het
Ctbp2 C A 7: 132,990,060 V338L probably benign Het
Cyp2d22 A G 15: 82,374,411 V83A possibly damaging Het
Daam1 G A 12: 71,977,649 R797H probably benign Het
Dab1 C A 4: 104,720,559 S275* probably null Het
Dgkz T C 2: 91,937,059 E863G probably benign Het
Dhx34 G A 7: 16,212,864 A515V possibly damaging Het
Dnah14 T C 1: 181,702,484 probably null Het
Dnmt3b C A 2: 153,672,220 N384K probably benign Het
Dock5 A G 14: 67,796,005 Y972H probably benign Het
Etv5 A T 16: 22,412,847 Y138* probably null Het
Fdps A G 3: 89,101,090 S4P probably damaging Het
Gart A G 16: 91,622,965 F885L possibly damaging Het
Gm32687 A T 10: 81,879,494 H240L probably damaging Het
Gm34653 T G 2: 34,838,425 C79G probably damaging Het
Gm4553 C T 7: 142,165,647 G15R unknown Het
Gm572 C T 4: 148,668,951 T351M probably damaging Het
Gpr3 A T 4: 133,210,437 L308Q probably damaging Het
Gpsm2 A G 3: 108,701,781 V174A probably benign Het
Gucy1a1 T C 3: 82,094,789 H661R unknown Het
Heatr4 A T 12: 83,957,725 M774K probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Ift81 C T 5: 122,609,331 V91M probably damaging Het
Igsf10 G T 3: 59,331,543 Q406K probably damaging Het
Il10ra A G 9: 45,260,399 V257A probably benign Het
Ina A T 19: 47,023,643 K500I Het
Lce1i A T 3: 92,777,759 C37S unknown Het
Lrrc59 A T 11: 94,634,985 D133V probably damaging Het
Magi3 A G 3: 104,034,038 I867T probably damaging Het
Mmaa T A 8: 79,269,201 R298W probably damaging Het
Mon1a G T 9: 107,900,128 V77F probably benign Het
Mrc2 A G 11: 105,346,459 T1030A probably benign Het
Mrps27 T A 13: 99,404,996 S162T probably benign Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Mtus1 A G 8: 41,054,650 I21T possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nbr1 T G 11: 101,556,241 F18V probably damaging Het
Npy2r T C 3: 82,540,382 N362S probably benign Het
Ocln T A 13: 100,539,598 Y129F probably damaging Het
Olfr1258 T C 2: 89,929,881 I24T probably benign Het
Olfr31 T C 14: 14,328,384 I91T probably damaging Het
Olfr898 A G 9: 38,349,277 M59V probably benign Het
Pik3c2b T G 1: 133,079,841 probably null Het
Prss39 A G 1: 34,502,628 D262G probably damaging Het
Ptk7 T A 17: 46,571,643 D886V possibly damaging Het
Ptprg T A 14: 12,226,452 D1348E probably damaging Het
Rabgap1 T C 2: 37,537,327 I640T possibly damaging Het
Rogdi A G 16: 5,009,234 Y303H probably damaging Het
Rps6kb1 A T 11: 86,513,322 M283K probably damaging Het
Sardh T A 2: 27,241,517 T188S possibly damaging Het
Sebox A G 11: 78,504,093 E87G probably damaging Het
Smchd1 A T 17: 71,358,198 M1830K probably damaging Het
Spink8 G A 9: 109,816,780 V7I probably benign Het
Src G A 2: 157,457,244 V54M probably benign Het
Taar2 A G 10: 23,940,723 I54V probably benign Het
Tpo A T 12: 30,131,860 V12E possibly damaging Het
Txk T C 5: 72,707,575 D373G probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vil1 C T 1: 74,426,595 T515M probably benign Het
Wdr47 G T 3: 108,618,521 C120F probably damaging Het
Ylpm1 C T 12: 85,013,025 P335L unknown Het
Zfp148 T A 16: 33,468,175 I220N probably damaging Het
Zfp992 A T 4: 146,467,165 K448* probably null Het
Zfp994 T C 17: 22,200,425 I514M probably benign Het
Zp2 A T 7: 120,135,775 I429N probably damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAATAAGGCCGCCATGATGG -3'
(R):5'- ACCAAATCCTGAAGCCTGAG -3'

Sequencing Primer
(F):5'- TGAAGGACCTGCAGCTGC -3'
(R):5'- TGTCTCATACACACCTGG -3'
Posted On2019-11-12