Incidental Mutation 'R7709:Mrps27'
ID594490
Institutional Source Beutler Lab
Gene Symbol Mrps27
Ensembl Gene ENSMUSG00000041632
Gene Namemitochondrial ribosomal protein S27
Synonyms2610028H14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R7709 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location99344786-99415562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99404996 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 162 (S162T)
Ref Sequence ENSEMBL: ENSMUSP00000062326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052249] [ENSMUST00000224660]
Predicted Effect probably benign
Transcript: ENSMUST00000052249
AA Change: S162T

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062326
Gene: ENSMUSG00000041632
AA Change: S162T

DomainStartEndE-ValueType
Pfam:MRP-S27 1 413 8.3e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224660
AA Change: S203T

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,407,685 I443T probably damaging Het
2310002L09Rik A G 4: 73,942,854 C170R possibly damaging Het
4932415D10Rik A C 10: 82,290,532 S2215A possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,587,410 probably null Het
A2m A C 6: 121,660,104 T809P possibly damaging Het
Abca12 T C 1: 71,335,728 D340G probably benign Het
Abcg8 A T 17: 84,692,491 D191V probably damaging Het
Acan G T 7: 79,089,608 V255F probably damaging Het
Ace G A 11: 105,988,837 V1248I probably benign Het
Adgre1 A T 17: 57,402,519 Q87L unknown Het
Adgrl1 G A 8: 83,938,988 V1435M probably benign Het
Ano8 T C 8: 71,482,289 D423G probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Arl5a T C 2: 52,405,056 D114G probably benign Het
Baiap2l2 G T 15: 79,259,711 N394K probably benign Het
Cap1 A T 4: 122,862,674 C355S probably damaging Het
Ccdc25 A T 14: 65,840,484 D22V probably damaging Het
Ceacam2 T C 7: 25,538,651 D116G probably damaging Het
Clec4b2 A G 6: 123,173,015 probably benign Het
CN725425 C A 15: 91,240,727 R157S probably benign Het
Coq8b T C 7: 27,250,537 I347T probably damaging Het
Ctbp2 C A 7: 132,990,060 V338L probably benign Het
Cyp2d22 A G 15: 82,374,411 V83A possibly damaging Het
Daam1 G A 12: 71,977,649 R797H probably benign Het
Dab1 C A 4: 104,720,559 S275* probably null Het
Dgkz T C 2: 91,937,059 E863G probably benign Het
Dhx34 G A 7: 16,212,864 A515V possibly damaging Het
Dnah14 T C 1: 181,702,484 probably null Het
Dnmt3b C A 2: 153,672,220 N384K probably benign Het
Dock5 A G 14: 67,796,005 Y972H probably benign Het
Etv5 A T 16: 22,412,847 Y138* probably null Het
Fdps A G 3: 89,101,090 S4P probably damaging Het
Gart A G 16: 91,622,965 F885L possibly damaging Het
Gm32687 A T 10: 81,879,494 H240L probably damaging Het
Gm34653 T G 2: 34,838,425 C79G probably damaging Het
Gm4553 C T 7: 142,165,647 G15R unknown Het
Gm572 C T 4: 148,668,951 T351M probably damaging Het
Gpr3 A T 4: 133,210,437 L308Q probably damaging Het
Gpsm2 A G 3: 108,701,781 V174A probably benign Het
Gucy1a1 T C 3: 82,094,789 H661R unknown Het
Heatr4 A T 12: 83,957,725 M774K probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Ift81 C T 5: 122,609,331 V91M probably damaging Het
Igsf10 G T 3: 59,331,543 Q406K probably damaging Het
Il10ra A G 9: 45,260,399 V257A probably benign Het
Ina A T 19: 47,023,643 K500I Het
Lce1i A T 3: 92,777,759 C37S unknown Het
Lrrc59 A T 11: 94,634,985 D133V probably damaging Het
Magi3 A G 3: 104,034,038 I867T probably damaging Het
Mmaa T A 8: 79,269,201 R298W probably damaging Het
Mon1a G T 9: 107,900,128 V77F probably benign Het
Mrc2 A G 11: 105,346,459 T1030A probably benign Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Mtus1 A G 8: 41,054,650 I21T possibly damaging Het
Myh2 T C 11: 67,194,864 V1844A probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nbr1 T G 11: 101,556,241 F18V probably damaging Het
Npy2r T C 3: 82,540,382 N362S probably benign Het
Ocln T A 13: 100,539,598 Y129F probably damaging Het
Olfr1258 T C 2: 89,929,881 I24T probably benign Het
Olfr31 T C 14: 14,328,384 I91T probably damaging Het
Olfr898 A G 9: 38,349,277 M59V probably benign Het
Pik3c2b T G 1: 133,079,841 probably null Het
Prss39 A G 1: 34,502,628 D262G probably damaging Het
Ptk7 T A 17: 46,571,643 D886V possibly damaging Het
Ptprg T A 14: 12,226,452 D1348E probably damaging Het
Rabgap1 T C 2: 37,537,327 I640T possibly damaging Het
Rogdi A G 16: 5,009,234 Y303H probably damaging Het
Rps6kb1 A T 11: 86,513,322 M283K probably damaging Het
Sardh T A 2: 27,241,517 T188S possibly damaging Het
Sebox A G 11: 78,504,093 E87G probably damaging Het
Smchd1 A T 17: 71,358,198 M1830K probably damaging Het
Spink8 G A 9: 109,816,780 V7I probably benign Het
Src G A 2: 157,457,244 V54M probably benign Het
Taar2 A G 10: 23,940,723 I54V probably benign Het
Tpo A T 12: 30,131,860 V12E possibly damaging Het
Txk T C 5: 72,707,575 D373G probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vil1 C T 1: 74,426,595 T515M probably benign Het
Wdr47 G T 3: 108,618,521 C120F probably damaging Het
Ylpm1 C T 12: 85,013,025 P335L unknown Het
Zfp148 T A 16: 33,468,175 I220N probably damaging Het
Zfp992 A T 4: 146,467,165 K448* probably null Het
Zfp994 T C 17: 22,200,425 I514M probably benign Het
Zp2 A T 7: 120,135,775 I429N probably damaging Het
Other mutations in Mrps27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Mrps27 APN 13 99409816 missense probably damaging 1.00
IGL01685:Mrps27 APN 13 99414920 missense possibly damaging 0.52
P0043:Mrps27 UTSW 13 99412246 missense probably benign
R0122:Mrps27 UTSW 13 99365228 missense probably benign 0.13
R0502:Mrps27 UTSW 13 99409795 splice site probably benign
R0503:Mrps27 UTSW 13 99409795 splice site probably benign
R0611:Mrps27 UTSW 13 99405074 missense probably damaging 1.00
R1540:Mrps27 UTSW 13 99405050 missense probably benign 0.17
R2566:Mrps27 UTSW 13 99400328 nonsense probably null
R4227:Mrps27 UTSW 13 99411340 missense probably damaging 1.00
R4235:Mrps27 UTSW 13 99405041 missense probably damaging 1.00
R4715:Mrps27 UTSW 13 99414815 unclassified probably null
R4761:Mrps27 UTSW 13 99412231 missense probably benign 0.10
R5114:Mrps27 UTSW 13 99411465 unclassified probably benign
R5294:Mrps27 UTSW 13 99409873 missense probably damaging 1.00
R6241:Mrps27 UTSW 13 99412246 missense probably benign
R6387:Mrps27 UTSW 13 99400317 missense possibly damaging 0.80
R6491:Mrps27 UTSW 13 99363030 missense probably damaging 1.00
R6992:Mrps27 UTSW 13 99405014 missense probably benign 0.16
R7165:Mrps27 UTSW 13 99414799 missense possibly damaging 0.89
R7241:Mrps27 UTSW 13 99411280 nonsense probably null
R7720:Mrps27 UTSW 13 99401330 missense unknown
Z1177:Mrps27 UTSW 13 99414843 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGAATGGCTTGACAAGGACC -3'
(R):5'- CAGGTTCAGAGAGCAAGGTTCC -3'

Sequencing Primer
(F):5'- CTTGACAAGGACCTGCTTCGTAG -3'
(R):5'- CTCGTCGTCTTAACTGGGCAG -3'
Posted On2019-11-12