Incidental Mutation 'R7709:Ptprg'
ID594492
Institutional Source Beutler Lab
Gene Symbol Ptprg
Ensembl Gene ENSMUSG00000021745
Gene Nameprotein tyrosine phosphatase, receptor type, G
Synonyms5430405N12Rik, RPTPgamma
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7709 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location11553532-12242041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12226452 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1348 (D1348E)
Ref Sequence ENSEMBL: ENSMUSP00000022264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]
Predicted Effect probably damaging
Transcript: ENSMUST00000022264
AA Change: D1348E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: D1348E

DomainStartEndE-ValueType
Carb_anhydrase 60 321 6.38e-109 SMART
FN3 347 433 5.4e-7 SMART
low complexity region 474 484 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
transmembrane domain 734 756 N/A INTRINSIC
PTPc 844 1118 1.76e-136 SMART
PTPc 1146 1409 1.32e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119888
AA Change: D573E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: D573E

DomainStartEndE-ValueType
PTPc 69 343 1.76e-136 SMART
PTPc 371 634 1.32e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142917
SMART Domains Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

DomainStartEndE-ValueType
Carb_anhydrase 60 260 1.6e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,407,685 I443T probably damaging Het
2310002L09Rik A G 4: 73,942,854 C170R possibly damaging Het
4932415D10Rik A C 10: 82,290,532 S2215A possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,587,410 probably null Het
A2m A C 6: 121,660,104 T809P possibly damaging Het
Abca12 T C 1: 71,335,728 D340G probably benign Het
Abcg8 A T 17: 84,692,491 D191V probably damaging Het
Acan G T 7: 79,089,608 V255F probably damaging Het
Ace G A 11: 105,988,837 V1248I probably benign Het
Adgre1 A T 17: 57,402,519 Q87L unknown Het
Adgrl1 G A 8: 83,938,988 V1435M probably benign Het
Ano8 T C 8: 71,482,289 D423G probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Arl5a T C 2: 52,405,056 D114G probably benign Het
Baiap2l2 G T 15: 79,259,711 N394K probably benign Het
Cap1 A T 4: 122,862,674 C355S probably damaging Het
Ccdc25 A T 14: 65,840,484 D22V probably damaging Het
Ceacam2 T C 7: 25,538,651 D116G probably damaging Het
Clec4b2 A G 6: 123,173,015 probably benign Het
CN725425 C A 15: 91,240,727 R157S probably benign Het
Coq8b T C 7: 27,250,537 I347T probably damaging Het
Ctbp2 C A 7: 132,990,060 V338L probably benign Het
Cyp2d22 A G 15: 82,374,411 V83A possibly damaging Het
Daam1 G A 12: 71,977,649 R797H probably benign Het
Dab1 C A 4: 104,720,559 S275* probably null Het
Dgkz T C 2: 91,937,059 E863G probably benign Het
Dhx34 G A 7: 16,212,864 A515V possibly damaging Het
Dnah14 T C 1: 181,702,484 probably null Het
Dnmt3b C A 2: 153,672,220 N384K probably benign Het
Dock5 A G 14: 67,796,005 Y972H probably benign Het
Etv5 A T 16: 22,412,847 Y138* probably null Het
Fdps A G 3: 89,101,090 S4P probably damaging Het
Gart A G 16: 91,622,965 F885L possibly damaging Het
Gm32687 A T 10: 81,879,494 H240L probably damaging Het
Gm34653 T G 2: 34,838,425 C79G probably damaging Het
Gm4553 C T 7: 142,165,647 G15R unknown Het
Gm572 C T 4: 148,668,951 T351M probably damaging Het
Gpr3 A T 4: 133,210,437 L308Q probably damaging Het
Gpsm2 A G 3: 108,701,781 V174A probably benign Het
Gucy1a1 T C 3: 82,094,789 H661R unknown Het
Heatr4 A T 12: 83,957,725 M774K probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Ift81 C T 5: 122,609,331 V91M probably damaging Het
Igsf10 G T 3: 59,331,543 Q406K probably damaging Het
Il10ra A G 9: 45,260,399 V257A probably benign Het
Ina A T 19: 47,023,643 K500I Het
Lce1i A T 3: 92,777,759 C37S unknown Het
Lrrc59 A T 11: 94,634,985 D133V probably damaging Het
Magi3 A G 3: 104,034,038 I867T probably damaging Het
Mmaa T A 8: 79,269,201 R298W probably damaging Het
Mon1a G T 9: 107,900,128 V77F probably benign Het
Mrc2 A G 11: 105,346,459 T1030A probably benign Het
Mrps27 T A 13: 99,404,996 S162T probably benign Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Mtus1 A G 8: 41,054,650 I21T possibly damaging Het
Myh2 T C 11: 67,194,864 V1844A probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nbr1 T G 11: 101,556,241 F18V probably damaging Het
Npy2r T C 3: 82,540,382 N362S probably benign Het
Ocln T A 13: 100,539,598 Y129F probably damaging Het
Olfr1258 T C 2: 89,929,881 I24T probably benign Het
Olfr31 T C 14: 14,328,384 I91T probably damaging Het
Olfr898 A G 9: 38,349,277 M59V probably benign Het
Pik3c2b T G 1: 133,079,841 probably null Het
Prss39 A G 1: 34,502,628 D262G probably damaging Het
Ptk7 T A 17: 46,571,643 D886V possibly damaging Het
Rabgap1 T C 2: 37,537,327 I640T possibly damaging Het
Rogdi A G 16: 5,009,234 Y303H probably damaging Het
Rps6kb1 A T 11: 86,513,322 M283K probably damaging Het
Sardh T A 2: 27,241,517 T188S possibly damaging Het
Sebox A G 11: 78,504,093 E87G probably damaging Het
Smchd1 A T 17: 71,358,198 M1830K probably damaging Het
Spink8 G A 9: 109,816,780 V7I probably benign Het
Src G A 2: 157,457,244 V54M probably benign Het
Taar2 A G 10: 23,940,723 I54V probably benign Het
Tpo A T 12: 30,131,860 V12E possibly damaging Het
Txk T C 5: 72,707,575 D373G probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Vil1 C T 1: 74,426,595 T515M probably benign Het
Wdr47 G T 3: 108,618,521 C120F probably damaging Het
Ylpm1 C T 12: 85,013,025 P335L unknown Het
Zfp148 T A 16: 33,468,175 I220N probably damaging Het
Zfp992 A T 4: 146,467,165 K448* probably null Het
Zfp994 T C 17: 22,200,425 I514M probably benign Het
Zp2 A T 7: 120,135,775 I429N probably damaging Het
Other mutations in Ptprg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ptprg APN 14 12215992 missense probably damaging 1.00
IGL00484:Ptprg APN 14 12215220 missense probably damaging 0.99
IGL00847:Ptprg APN 14 12215265 missense probably damaging 1.00
IGL01089:Ptprg APN 14 12215286 missense probably damaging 0.97
IGL01382:Ptprg APN 14 12237797 missense probably benign 0.16
IGL01470:Ptprg APN 14 12213702 nonsense probably null
IGL01762:Ptprg APN 14 12037386 missense probably benign 0.00
IGL01886:Ptprg APN 14 12179280 missense probably benign 0.22
IGL01963:Ptprg APN 14 12220661 missense probably damaging 1.00
IGL02015:Ptprg APN 14 12237782 missense possibly damaging 0.46
IGL02086:Ptprg APN 14 12110080 nonsense probably null
IGL02197:Ptprg APN 14 12220613 missense probably damaging 0.98
IGL02341:Ptprg APN 14 12154360 missense probably benign 0.00
IGL02732:Ptprg APN 14 12225617 critical splice donor site probably null
IGL03011:Ptprg APN 14 12219029 missense probably damaging 1.00
IGL03261:Ptprg APN 14 12225552 missense probably damaging 0.99
R0038:Ptprg UTSW 14 12213710 missense probably damaging 1.00
R0383:Ptprg UTSW 14 12219024 missense possibly damaging 0.93
R0433:Ptprg UTSW 14 12220620 missense probably damaging 1.00
R0488:Ptprg UTSW 14 12220653 missense probably damaging 1.00
R0503:Ptprg UTSW 14 12237138 missense possibly damaging 0.89
R0520:Ptprg UTSW 14 12199783 missense possibly damaging 0.92
R0570:Ptprg UTSW 14 12215896 missense probably damaging 1.00
R0606:Ptprg UTSW 14 12154131 missense probably benign
R1086:Ptprg UTSW 14 11952706 splice site probably benign
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1519:Ptprg UTSW 14 12220596 missense probably damaging 1.00
R1662:Ptprg UTSW 14 12207357 missense probably damaging 1.00
R1714:Ptprg UTSW 14 12213697 missense probably damaging 1.00
R1716:Ptprg UTSW 14 12154360 missense probably benign 0.00
R1797:Ptprg UTSW 14 12199743 missense probably damaging 1.00
R1803:Ptprg UTSW 14 12091410 splice site probably null
R2104:Ptprg UTSW 14 11952897 critical splice donor site probably null
R2125:Ptprg UTSW 14 12179283 missense possibly damaging 0.74
R2126:Ptprg UTSW 14 12154355 missense probably benign
R2133:Ptprg UTSW 14 12211637 missense probably damaging 1.00
R2471:Ptprg UTSW 14 12210327 missense probably damaging 1.00
R2571:Ptprg UTSW 14 12122135 missense probably benign
R3821:Ptprg UTSW 14 12226375 missense probably benign 0.00
R4196:Ptprg UTSW 14 12122002 missense possibly damaging 0.51
R4392:Ptprg UTSW 14 12142467 missense possibly damaging 0.80
R4665:Ptprg UTSW 14 12215288 missense possibly damaging 0.90
R4730:Ptprg UTSW 14 12213713 missense probably damaging 1.00
R4737:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R4764:Ptprg UTSW 14 12122068 missense probably benign 0.01
R4801:Ptprg UTSW 14 11554233 utr 5 prime probably benign
R4825:Ptprg UTSW 14 12220654 missense probably damaging 1.00
R4960:Ptprg UTSW 14 12237837 missense probably benign 0.07
R4972:Ptprg UTSW 14 12226427 missense possibly damaging 0.94
R4980:Ptprg UTSW 14 12154421 missense probably benign 0.16
R5004:Ptprg UTSW 14 12220667 missense probably damaging 1.00
R5058:Ptprg UTSW 14 12037387 missense possibly damaging 0.82
R5182:Ptprg UTSW 14 12154174 missense probably benign
R5258:Ptprg UTSW 14 12142431 missense probably benign 0.11
R5338:Ptprg UTSW 14 12154111 missense probably benign
R5353:Ptprg UTSW 14 11554235 utr 5 prime probably benign
R5373:Ptprg UTSW 14 12213665 missense probably benign 0.00
R5387:Ptprg UTSW 14 12153873 missense probably damaging 1.00
R5616:Ptprg UTSW 14 12122120 missense probably benign
R5623:Ptprg UTSW 14 12153857 missense probably damaging 1.00
R5976:Ptprg UTSW 14 12211625 missense probably damaging 0.96
R6027:Ptprg UTSW 14 12220613 missense possibly damaging 0.87
R6091:Ptprg UTSW 14 12215979 missense probably damaging 1.00
R6184:Ptprg UTSW 14 12153943 missense probably benign 0.00
R6234:Ptprg UTSW 14 12213747 missense probably damaging 1.00
R6318:Ptprg UTSW 14 12237118 missense probably damaging 1.00
R6324:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R6334:Ptprg UTSW 14 12166832 missense probably damaging 1.00
R6646:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6647:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6992:Ptprg UTSW 14 11962602 missense probably damaging 1.00
R7088:Ptprg UTSW 14 12207365 missense probably damaging 1.00
R7250:Ptprg UTSW 14 12166767 missense probably benign 0.18
R7342:Ptprg UTSW 14 12237151 missense possibly damaging 0.90
R7358:Ptprg UTSW 14 12154198 missense possibly damaging 0.59
R7410:Ptprg UTSW 14 11962657 missense probably damaging 1.00
R7448:Ptprg UTSW 14 12142461 missense probably benign 0.12
R7514:Ptprg UTSW 14 12179342 missense possibly damaging 0.86
R7523:Ptprg UTSW 14 12237130 missense probably damaging 0.97
R7672:Ptprg UTSW 14 12211668 missense probably benign 0.04
R7720:Ptprg UTSW 14 12211703 missense probably benign 0.31
X0020:Ptprg UTSW 14 12110070 frame shift probably null
X0027:Ptprg UTSW 14 12110070 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGATGCGTGCTTTCTAGGGAAC -3'
(R):5'- GAATACTTGGAGCCCAGCAAAG -3'

Sequencing Primer
(F):5'- CTTTCTAGGGAACAGGCATTTG -3'
(R):5'- CTTGGAGCCCAGCAAAGTTTGAC -3'
Posted On2019-11-12